KEGG   Streptococcus pyogenes NZ131 (serotype M49): Spy49_tRNAthr4Help
Entry
Spy49_tRNAthr4    tRNA      T00780                                 

Definition
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
soz  Streptococcus pyogenes NZ131 (serotype M49)
Pathway
soz00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:soz00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Spy49_tRNAthr4
Non-coding RNAs [BR:soz03100]
 Transfer RNA
  tRNA
   Spy49_tRNAthr4
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1247599..1247671)
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
gccggcttagctcagttggtagagcatctgatttgtaatcagagggtcgcgtgttcaagt
catgtagccggca

DBGET integrated database retrieval system