KEGG   Shewanella pealeana: Spea_2005Help
Entry
Spea_2005         CDS       T00606                                 

Definition
(RefSeq) malate synthase
  KO
K01638  
malate synthase [EC:2.3.3.9]
Organism
spl  Shewanella pealeana
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:spl00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    Spea_2005
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    Spea_2005
   00630 Glyoxylate and dicarboxylate metabolism
    Spea_2005
Enzymes [BR:spl01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     Spea_2005
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
2428976..2429491
Genome map
AA seq 171 aa AA seqDB search
MDISTTNTSTQVNNNNGHYIGAELVDVKLVEVASNDVTALSAKDFLDAKFPLANGSHKNA
CSYVIYYQQLLVFMADGSQTGLRQPKQFVALNGHKSEPTAILLKDKGGHVELTFDRSKAN
TNRDLANLQDIQLEGHEYWISLINIENTVVASSMQDQVFTAKDGSDYLLKS
NT seq 516 nt NT seq  +upstreamnt  +downstreamnt
atggatatatcaacaacgaatactagtactcaagtaaataacaataacggtcattatatt
ggtgcagaacttgttgatgtgaaacttgtcgaggtggcaagtaatgacgtaacggcctta
agtgcaaaagattttttagatgccaagtttccactcgctaatggttctcataaaaatgcc
tgtagctatgtgatctattatcagcaattattggtgttcatggcagatggcagccaaaca
ggattacgccagcctaagcagtttgttgcgctaaacggtcataaaagtgaacctacagcg
attctgttgaaggacaaggggggtcatgtggagttaactttcgataggagtaaggcaaat
actaatcgagacctagccaaccttcaggatatacagctagaagggcatgagtattggatc
agtttgattaacatcgaaaacactgtggttgcatcttctatgcaagatcaagtatttacc
gctaaagatggcagtgactacctactaaaaagttaa

DBGET integrated database retrieval system