KEGG   Schizosaccharomyces pombe (fission yeast): SPNCRNA.406Help
Entry
SPNCRNA.406       misc_RNA  T00076                                 

Definition
non-coding RNA (predicted)
Organism
spo  Schizosaccharomyces pombe (fission yeast)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
II:2738941..2739592
Genome map
NT seq 652 nt NT seq  +upstreamnt  +downstreamnt
atgttcaaaatcaaattaaatagataacaaagtgaagaaaatgtttacaagaatcaatga
aatttatttaaaaaatattgtcaaaattattgctaaatatatgatcaaattcattaccaa
aataacattacccatcgaacacccctaacaacttcccaaattacattcatcaaatgaatg
gtatactccgtcgctctttctaattcattcggccattctaaatccatgatcaaaagttta
gtgccgtctgctccaatatcgaccattttgagattcgcttagcaaaatgcgacacttctt
cgggccctatccattttcccgctgatagacataggagttttgcagctttgtccaattctc
ttccaaagggaatttcaaattgttaacctagtaaatgtagtggtgaaagtggtatactga
atgtgccttcacaatccatataaatcgtcaacctgaagcctgtgttttcctccatacaaa
ggtttacacttgctgggaacctaggcggcaaaaagcgtgatgccatatgtttggccttca
agcattctgttcgtctgtgcatttcacgtttcaataaaaaacatatagcggccggatgtt
attggcattttcaaaaattgacaaattgttatctcgaaaaaaatttcccatc

DBGET integrated database retrieval system