KEGG   Streptococcus pneumoniae R6 (avirulent): spr1989Help
Entry
spr1989           gene      T00060                                 

Gene name
glpD-truncation
Definition
pseudogene
Organism
spr  Streptococcus pneumoniae R6 (avirulent)
Class
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
complement(1980346..1982174)
Genome map
NT seq 1829 nt NT seq  +upstreamnt  +downstreamnt
atggaattttcaaaaaaaacacgtgaattgtcaattaaaaaaatgcaggaacgcaccctg
gacctcttgattatcggtggaggaatcacaggagctggtgtagccttgcaggcggcagct
agcggtcttgagactggtttgattgaaatgcaagactttgcagaaggaacatctagtcgt
tcaacaaaattggttcacggaggtcttcgctacctcaaacaattcgacgtagaagtggtc
tcagatacggtttctgaacgtgcagtggttcaacaaatcgctccacacattccaaaacca
gatccaatgctcttaccagtttacgatgaagatggagcaacctttagcctcttccgtctt
aaagtagccatggacttgtacgacctcttggcaggtgttagcaacacaccaactgcgaac
aaggttttgagcaaggatcaagtcttggaacgccagccaaacttgaagaaggaaggcttg
gtaggaggtggagtgtatcttgacttccgtaacaacgatgcgcgtctcgtgattgaaaac
atcaaacgtgccaaccaagacggtgccctcattgccaaccacgtgaaggcagaaggcttc
ctctttgacgaaagtggcaagattacaggtgttgtagctcgtgatctcttgacagaccaa
gtatttgaaatcaaggcccgtctggttattaatacaacaggtccttggagtgataaagta
cgtaatttgtctaataagggaacgcaattctcacaaatgcgcccaactaagggagttcac
ttggtagtggattcaagcaaaatcaaggtttcacagccagtttactttgacacaggtttg
ggtgacggtcgtatggtctttgttctcccacgtgaaaacaagacttactttggtacaact
gatacagactacacaggtgatttggagcatccaaaagtaactcaagaagatgtagattat
ctacttggcattgtcaacaaccgctttccagaatccaacatcaccattgatgatatcgaa
agcagctgggcaggtcttcgtccattgattgcagggaacagtgcctctgactataatggt
ggaaataacggtaccatcagtgatgaaagctttgacaacttgattgcgactgttgaatct
tatctctccaaagaaaaaacacgtgaagatgttgagtctgctgtcagcaagcttgaaagt
agcacatctgagaaacatttggatccatctgcagtttctcgtgggtctagcttggatcgt
gatgacaatggtcttttgactcttgctggcggtaaaatcacagactaccgtaagatgggt
gacgaggcgctatggagcgcgtggttgacatcctcaaagcagaatttgaccgtagcttta
aattgatcaattctaaaacttaccctgtttcaggtggagaattgaacccagcaaatgtgg
attcagaaatcgaagcctttgcgcaacttggagtttcacgtggtttggatagcaaggaag
ctcattacctagcaaatctttacggttcaaatgcaccgaaggtctttgcacttgctcaca
gcttggaacaagcgccaggactcagcttggcagatactttgtcccttcactatgcaatgc
gcaacgagttggctcttagcccagttgacttccttcttcgtcgtaccaaccatatgctct
ttatgcgtgatagcttggatagcatcgttgagccagttttggatgaaatgggacgattct
atgactggacagaagaagaaaaagcaacttaccgtgctgatgtcgaagcagctctcgcta
acaacgatttagcagaattaaaaaattaa

DBGET integrated database retrieval system