KEGG   Streptomyces sp. SirexAA-E: SACTE_2592Help
Entry
SACTE_2592        gene      T01601                                 

Definition
(GenBank) pseudogene
Organism
ssx  Streptomyces sp. SirexAA-E
SSDB OrthologParalogGene clusterGFIT
Position
2927146..2927413
Genome map
NT seq 268 nt NT seq  +upstreamnt  +downstreamnt
atgaccgccgagccgatcgccgggcacagcagccgctggccggtaccggctcaggacgga
tacaccggtggacgacctgttcaccctcccgcacttctgtctggtggaaacggcgggcag
cgaccggcatccggtcgtccgggtccacgagctggacccggtgaccaagtcgtacgccct
gacgggcatccaccacgaccggctcaagacctccgtgccgttcccggtcgacgtcgacgt
ctcgtcggacgccctcggctccctgtga

DBGET integrated database retrieval system