KEGG   Streptomyces sp. SirexAA-E: SACTE_R0040Help
Entry
SACTE_R0040       tRNA      T01601                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  
tRNA Arg
Organism
ssx  Streptomyces sp. SirexAA-E
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ssx00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    SACTE_R0040
Non-coding RNAs [BR:ssx03100]
 Transfer RNA
  tRNA
   SACTE_R0040
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
3010135..3010207
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
gccttcgtagctcaggggatagagcaccgctctcctaaagcgggtgtcgcaggttcgaat
cctgccgggggca

DBGET integrated database retrieval system