KEGG   Streptococcus parauberis: STP_1496Help
Entry
STP_1496          CDS       T01504                                 

Definition
sucrose phosphorylase
Orthology
K00690  
sucrose phosphorylase [EC:2.4.1.7]
Organism
stk  Streptococcus parauberis
Pathway
Starch and sucrose metabolism
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:stk00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
complement(1678960..1679262)
Genome map
AA seq 100 aa AA seqDB search
MELLERTKEGRNINRHYYTSQEIAKEVERPLVKSLLKLFSYRNNSYAFDLEGSISVQTPD
DNSIVIVRSDKDQSVTAELQLNLNDDTYQVIENGQTVLFD
NT seq 303 nt NT seq  +upstreamnt  +downstreamnt
ttggaattgctagagcgcaccaaagaaggtcgaaatatcaacagacattactacactagc
caagaaattgcaaaagaagtggaacgtccattagtgaaatcactcttgaaactatttagt
tacaggaataattcatatgcttttgatcttgaaggaagtatctctgtacaaacaccagat
gataattcaattgtcattgtaagaagcgataaagatcagagtgtaacggctgaattacag
cttaacttaaacgatgacacctatcaagtaatagaaaatggacaaaccgtattatttgat
taa

DBGET integrated database retrieval system