KEGG   Streptomyces venezuelae: SVEN_6426Help
Entry
SVEN_6426         CDS       T02274                                 

Definition
(GenBank) hypothetical protein
Organism
sve  Streptomyces venezuelae
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: HEAT_2
Motif
Other DBs
NCBI-ProteinID: CCA59712
UniProt: F2RF27
Position
7011513..7011914
Genome map
AA seq 133 aa AA seqDB search
MTDLLTRLTEMLDDLDADVDETIDLADEIAASGDAALLPRLQAELDRALTERNAYARELL
GGVLAAIGGPDALPTLIRASAVDLGDDQDGLATEIVDLVQADPKAARGLLQPLTEDDDLS
VANRADWALRFLP
NT seq 402 nt NT seq  +upstreamnt  +downstreamnt
atgaccgacctgctgacccggctcaccgagatgctggacgacctcgacgcggacgtcgac
gagacgatcgacctcgccgacgagatcgcggcctcgggcgacgccgctctcctgccgcgt
ctccaggcggagctcgaccgcgcgctcaccgagcggaacgcctacgcccgtgaactcctc
ggcggtgtcctcgccgccatcggcggcccggacgcgctgcccaccctgatccgggcgtcg
gccgtcgacctcggtgacgaccaggacggcctggccaccgagatcgtcgacctggtccag
gcggacccgaaggcggcccgggggctgctccagcccctcacggaggacgacgacctctcg
gtcgccaaccgggccgactgggccctgcgcttcctgccgtag

DBGET integrated database retrieval system