KEGG   Shewanella woodyi ATCC 51908: Swoo_3043Help
Entry
Swoo_3043         CDS       T00676                                 

Definition
malate synthase
Orthology
K01638  
malate synthase [EC:2.3.3.9]
Organism
swd  Shewanella woodyi ATCC 51908
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Class
Metabolism; Overview; Carbon metabolism [PATH:swd01200]
Metabolism; Carbohydrate metabolism; Pyruvate metabolism [PATH:swd00620]
Metabolism; Carbohydrate metabolism; Glyoxylate and dicarboxylate metabolism [PATH:swd00630]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
complement(3728830..3729342)
Genome map
AA seq 170 aa AA seqDB search
MNTSTMRSTQNEQQMNDLISAEVVSMDAYAASKSEDTVAKAKGFLDTAFPLATGSHKDVS
SYVVYYQNLLMFFKDGTHSGLRDPRQFVALNGHKSEPSAILLQDKGTHVALTFDRCGTTG
SQDLADIDDIQLEGHKYWISILNIDEEGRTPKTEQDQLFTAKDGSDYLLK
NT seq 513 nt NT seq  +upstreamnt  +downstreamnt
atgaatacatcaactatgagaagtactcaaaacgaacaacagatgaatgaccttatcagt
gctgaagtcgtgtctatggatgcctatgctgcatcaaaaagtgaagacacagtagctaag
gctaaagggtttcttgatactgcatttccattggcaacgggttcacataaagatgtcagt
agctatgttgtttattaccaaaaccttttgatgttctttaaagatggtactcacagcggt
ttacgtgacccacgtcaatttgttgcccttaatggacataagagtgagccatcagcgatt
ttactgcaggataagggaactcatgtggcgctaacatttgaccgttgcggtacaacgggt
tcacaagatttagctgacatcgatgatatccaacttgaaggtcacaagtactggattagc
atactcaatattgatgaggagggcaggactccaaagacagaacaagatcagctgtttaca
gctaaagatggtagtgactacctgttaaaataa

DBGET integrated database retrieval system