KEGG   Shewanella piezotolerans: swp_2677Help
Entry
swp_2677          CDS       T00791                                 

Definition
(RefSeq) malate synthase
  KO
K01638  
malate synthase [EC:2.3.3.9]
Organism
swp  Shewanella piezotolerans
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:swp00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    swp_2677
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    swp_2677
   00630 Glyoxylate and dicarboxylate metabolism
    swp_2677
Enzymes [BR:swp01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     swp_2677
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
complement(2812593..2813105)
Genome map
AA seq 170 aa AA seqDB search
MDISTINSTANNHENNLYNGSDFVDVNVVRQAANDTSTPCAKLFLDDKFPLAKGSHKDAC
SYVVYYQQLLVFMKDGSQTGLRCPKQFVALNGHKSEPTAILLKDNGVHVELTFDRQSEKG
AEDCANIEDILVEGHQYWISLVNVENTVVASSVLDQEFTAKDGSDYQLKR
NT seq 513 nt NT seq  +upstreamnt  +downstreamnt
atggatatatcaacaatcaatagcactgcaaacaaccacgagaataatttatataatggt
tcggattttgttgatgtgaatgttgtccgtcaggcagcaaatgatacctcaacaccttgt
gccaaattatttttggatgacaagtttccgctagccaaaggatcccacaaggatgcttgc
agctatgttgtctactaccaacagctgttagtgtttatgaaagacggtagccaaacgggt
ttacgttgccctaagcagtttgtagcgctcaatggccataagagcgagcctaccgccatt
ttactcaaagataatggcgttcatgtggagttaacttttgatagacaaagtgaaaagggc
gcagaagattgtgccaacattgaggatatcttagttgaagggcaccaatattggataagc
ttagttaatgttgaaaatactgtggtagcttcatcggtactcgatcaagagtttacagca
aaagatggtagtgattaccagctaaagcgataa

DBGET integrated database retrieval system