KEGG   Synechocystis sp. PCC 6803 GT-S: SYNGTS_t0032Help
Entry
SYNGTS_t0032      tRNA      T02098                                 

Gene name
trnA
Definition
(GenBank) tRNA-Ala
Organism
syy  Synechocystis sp. PCC 6803 GT-S
SSDB OrthologParalogGene clusterGFIT
Position
complement(2581748..2581820)
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
ggggaattagctcagttggtagagcgctgcgatcgcaccgcagaggtcagggattcgagt
tccctattctcca

DBGET integrated database retrieval system