KEGG   Thermodesulfatator indicus: Thein_R0002Help
Entry
Thein_R0002       tRNA      T01546                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  
tRNA Leu
Organism
tid  Thermodesulfatator indicus
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:tid00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Thein_R0002
Non-coding RNAs [BR:tid03100]
 Transfer RNA
  tRNA
   Thein_R0002
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
120288..120375
Genome map
NT seq 88 nt NT seq  +upstreamnt  +downstreamnt
gcgggagtggcggaattggtagacgctccggacttaggatccggtggggctattccccgt
gggggttcaagtcccccctcccgcacca

DBGET integrated database retrieval system