KEGG   Turneriella parva: Turpa_R0017Help
Entry
Turpa_R0017       tRNA      T02157                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
tpx  Turneriella parva
Pathway
tpx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:tpx00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Turpa_R0017
Non-coding RNAs [BR:tpx03100]
 Transfer RNA
  tRNA
   Turpa_R0017
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(1992903..1992975)
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
gctcctatagctcagatggatagagcagcgccctcctaaggcgaagaccccagttcgact
ccgggtgggagca

DBGET integrated database retrieval system