KEGG   Tupaia chinensis (Chinese tree shrew): 102503149Help
Entry
102503149         CDS       T02978                                 

Gene name
SCD
Definition
(RefSeq) stearoyl-CoA desaturase
  KO
K00507  stearoyl-CoA desaturase (Delta-9 desaturase) [EC:1.14.19.1]
Organism
tup  Tupaia chinensis (Chinese tree shrew)
Pathway
tup01040  Biosynthesis of unsaturated fatty acids
tup01212  Fatty acid metabolism
tup03320  PPAR signaling pathway
tup04152  AMPK signaling pathway
Brite
KEGG Orthology (KO) [BR:tup00001]
 Metabolism
  Lipid metabolism
   01040 Biosynthesis of unsaturated fatty acids
    102503149 (SCD)
 Environmental Information Processing
  Signal transduction
   04152 AMPK signaling pathway
    102503149 (SCD)
 Organismal Systems
  Endocrine system
   03320 PPAR signaling pathway
    102503149 (SCD)
Enzymes [BR:tup01000]
 1. Oxidoreductases
  1.14  Acting on paired donors, with incorporation or reduction of molecular oxygen
   1.14.19  With oxidation of a pair of donors resulting in the reduction of O2 to two molecules of water
    1.14.19.1  stearoyl-CoA 9-desaturase
     102503149 (SCD)
Lipid biosynthesis proteins [BR:tup01004]
 Desaturase
  First
   102503149 (SCD)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 102503149
NCBI-ProteinID: XP_006157443
UniProt: L9JFI9
Position
Un
AA seq 359 aa AA seqDB search
MPAHLLQEEISSSYTTTTTITAPPSRVLQNGGGKLEKTSLCFDEDIRPEISDDIHDPSYQ
DKEGPAPKLEYVWRNIILMSLLHLGALYGIVLFPTSKFYTWLWVLFYYLVSALGITAGAH
RLWSHRTYKARLPLRLFLIIANTMAFQNDVYEWARDHRVHHKFSETHADPHNARRGFFFS
HVGWLLVRKHPAVKEKGALLDLSDLRAEKLVMFQRRYYVPGVLLMCFILPTLVPWCLWGE
TFMHSLYVATLLRYATVLNATWLVNSAAHLYGYRPYDKTINPRENILVSLGAVGEGFHNY
HHTFPYDYSASEYRWHINLTTFFIDCMAALGLAYDRKKVSKAAVLARIKRTGDGTYKSG
NT seq 1080 nt NT seq  +upstreamnt  +downstreamnt
atgccggcccacttgctgcaagaggagatctccagctcctacaccaccaccaccactatc
acagcccctccctccagggtcctgcagaatggaggcggcaagctggagaaaacgtccctg
tgctttgacgaggacatccgcccggaaatcagcgatgacatacacgaccccagctaccag
gacaaggagggcccggcgcccaagctggagtacgtctggagaaacatcatcctcatgtct
ctgctgcacttgggagccctgtatgggatcgtcttgtttcccacctccaagttctacacc
tggctctgggtgctgttctactacctggtcagtgccctgggcatcacggccggcgcacac
cgcctgtggagccaccgcacctacaaggctcggctgcccctgcggctcttcctgatcatc
gccaacaccatggccttccagaatgatgtttatgaatgggccagagatcaccgtgtccac
cacaagttctcggaaacacatgctgatcctcataacgcccgacgtggctttttcttctct
cacgtgggttggctgcttgtgcgcaaacacccagccgtcaaagagaagggtgctttgcta
gacttgtctgacctaagagctgagaaactggtgatgttccagaggaggtactacgtcccc
ggggtcctgctgatgtgcttcatcctgcccacactggtgccctggtgtctctggggagag
accttcatgcacagcttgtacgtcgccactttactgcgctacgccaccgtgctcaacgcc
acctggctggtgaacagcgctgcccacctctatggatatcgcccttatgacaagaccatc
aacccccgggagaacatcctggtctcactgggtgctgtgggtgagggcttccacaactat
caccacacctttccctatgactactccgccagtgagtaccgctggcacatcaacctaacc
acattcttcattgactgcatggcggccctcggcctggcttacgaccggaagaaagtgtcc
aaggccgcggtgctggcccggattaaaagaactggagatggaacctacaagagcggctga

DBGET integrated database retrieval system