KEGG   Thermoanaerobacter wiegelii: Thewi_0441Help
Entry
Thewi_0441        gene      T01607                                 

Definition
(GenBank) pseudogene
Organism
twi  Thermoanaerobacter wiegelii
SSDB OrthologParalogGene clusterGFIT
Position
470493..470981
Genome map
NT seq 489 nt NT seq  +upstreamnt  +downstreamnt
atgacctactcaaaagaagacctcaaaacaaagtgggaagaaaatgttaaaaaaatcaaa
gagttgcttgatgaggggaaagacgtagcttttataacaataggagaccctatgatttac
agcacctacatatacattttaaaaggaattgaggattacgaagtagagacgattcctgga
attacccctatagtgcagccgcctcaaggttaaatatcccaattgcggagggaaacgaga
cttttgcagtgatttcatcaggagatgtgggaaatttcaaaagctcttgatatgtttgat
aacgtggcattaatgaaaatttcgagaagatacgaggaaatagtaaatcttctaaaagaa
aaaagcttcaaggggtaccttgtgataaagtgcggccataaagaggaaaaaatatcctac
gaccttgatagatatatagggaaaaagatagactatttgtcactcattattgcaaagaag
gtgaagtag

DBGET integrated database retrieval system