KEGG   Thermoanaerobacter wiegelii: Thewi_0444Help
Entry
Thewi_0444        gene      T01607                                 

Definition
(GenBank) pseudogene
Organism
twi  Thermoanaerobacter wiegelii
SSDB OrthologParalogGene clusterGFIT
Position
472451..473077
Genome map
NT seq 627 nt NT seq  +upstreamnt  +downstreamnt
attaaagttcacaaaggggcgctggatgaactaagcctcattgattttatttataaaaac
tatatagatgttgtagttgatgcgactcatccttttgcaaaagatgtaagcataaatgct
ataaatgcctgtaacaaaactggtatcaagcatataaggtatgaaagagaaagtctatat
tactacaaagcgattgtagttaaaagttttgaagaggcagcagaagaatgtaagaaatac
gatagtatttttttgtcaataggtagcaaaaaccttgaaaaattcaaattcctttgggaa
gcagggaaaaaggtgacagtgagagtgcttccttcaagtagcgccataaaaaagtgtgaa
gatttaggattaaaacccaaagatataatagcgatggagggcccttttaccaaagagctt
aattatcaaatgtttaaagaaagaaatgcggaagtggttgtgacaaaagacagtggcatt
gtgggaggagtattagaaaaatttgaagctgctaaaatgctaggtattcctgtgatttta
ataaaaaggcctgatataaattatcctattgtagtaacagatgttgatagtctcataaat
gaggtgacaaaaagtggacataaataa

DBGET integrated database retrieval system