KEGG   Thermoanaerobacter wiegelii: Thewi_0475Help
Entry
Thewi_0475        gene      T01607                                 

Definition
(GenBank) pseudogene
Organism
twi  Thermoanaerobacter wiegelii
SSDB OrthologParalogGene clusterGFIT
Position
496135..496224
Genome map
NT seq 90 nt NT seq  +upstreamnt  +downstreamnt
gttttaacagcatctttaatgatgtttttagaatcgggagtgtttttactctttgcaaac
tttatatttgagaagttgggattaaaataa

DBGET integrated database retrieval system