KEGG   Thermoanaerobacter wiegelii: Thewi_0477Help
Entry
Thewi_0477        gene      T01607                                 

Definition
(GenBank) pseudogene
Organism
twi  Thermoanaerobacter wiegelii
SSDB OrthologParalogGene clusterGFIT
Position
496854..497015
Genome map
NT seq 162 nt NT seq  +upstreamnt  +downstreamnt
ttggtagaagttaagggattgactaaagtgtttaaaaacgtaagagctgtagacgattta
agttttaaggtaaaagaaggagaaatatacgggcttttaggtgaaaatggtgtaggcaaa
accacaactttgaggatgcttgctacaatggttaaacctaaa

DBGET integrated database retrieval system