KEGG   Thermoanaerobacter wiegelii: Thewi_0498Help
Entry
Thewi_0498        gene      T01607                                 

Definition
(GenBank) pseudogene
Organism
twi  Thermoanaerobacter wiegelii
SSDB OrthologParalogGene clusterGFIT
Position
complement(514471..514604)
Genome map
NT seq 134 nt NT seq  +upstreamnt  +downstreamnt
aataatcctccaaaaaactttgaagaaatagaacagtacaataaaaaactcattaaaaaa
gatgttcaggtaaagttacacaatacggataggcgatatatggctgtttttttgaacagt
ttatggctaagaga

DBGET integrated database retrieval system