KEGG   Variovorax paradoxus S110: Vapar_2711Help
Entry
Vapar_2711        gene      T00916                                 

Definition
(GenBank) pseudogene
Organism
vap  Variovorax paradoxus S110
SSDB OrthologParalogGene clusterGFIT
Position
1:2854286..2854941
Genome map
NT seq 656 nt NT seq  +upstreamnt  +downstreamnt
cagcggtcggtccggccccggagcagcgtggcggcaatggtcagaatcgacgaattccag
ccaatgcttttggacgagcggccgctagatctagacgagcccgggtggatctacgagctg
aagatggacggctaccgcgtgctggccgagttcgatggcgcagtacagctgcgcacccgt
aacggaaccgacgccacgacctggtttcccgaggtcacgcacagtttggccaagctgaag
aacggactgtgcgtggtggacggcgaggtttgcgtgctcgacgagatcgggcgcagcgac
ttcaaccagctgcaggaccgtgcgcggaggcgagggcggtatcccggggccccaccgtcg
cctactgtatcttcgacttgctggtgcaccgcggagtggacatcacgcagcggccgctgc
tcaagcgcaaggccgcgctcgcgaagatcctcaaacatccaggaccctctctcatgtacg
tgggccacttcgagagcggtgctgctcagcttttcaaggacgctgtgatcccgctgaagc
tggaagggctggtagcgaaacgcgccgacagcgtctatcggccgggtgtccgctcaagcg
actgggtgaaggtgaagcgcaagggcgcgataccggctgagcggttcaagcgctga

DBGET integrated database retrieval system