KEGG   Vibrio cholerae O1 biovar El Tor N16961: VCA0957Help
Entry
VCA0957           CDS       T00034                                 

Definition
malate synthase (EC:2.3.3.9)
Orthology
K01638  
malate synthase [EC:2.3.3.9]
Organism
vch  Vibrio cholerae O1 biovar El Tor N16961
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vch00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    VCA0957
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    VCA0957
   00630 Glyoxylate and dicarboxylate metabolism
    VCA0957
Enzymes [BR:vch01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     VCA0957
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JCVI-CMR: 
UniProt: 
Position
II:complement(905958..906566)
Genome map
AA seq 202 aa AA seqDB search
MTLNLDEGTTMNMLTFDKTEIQHQNKPFIAEAVFAVETVAANQQREKQTKAKQLLDRLFP
LENGTHQDVTAYVIDYNHLLAYFQDGRHSGLKYPKQFVAFNGSKENPSHLLFRDGQGSHV
EMTLGCQRGTGCIELREIADIQLETCTVLNHSNDHAQPSTTIRHWVSLIKGDEQGRPQAR
IEEKEYTARNGDEYFLGDCFSH
NT seq 609 nt NT seq  +upstreamnt  +downstreamnt
atgacattgaatctggacgagggaacgacgatgaacatgctgacgtttgataaaacagaa
atccaacaccaaaacaaaccctttatcgctgaagctgtgttcgccgtagaaacggtcgcc
gccaatcaacagcgtgaaaaacaaaccaaagccaaacagttattggatcgtctgtttccg
cttgaaaatggtactcaccaagatgtgaccgcatacgtgatagattacaaccatctgctc
gcttactttcaagatggacgtcatagtggcttgaaatacccaaaacagtttgtggcgttt
aatggcagtaaagaaaatccaagccatcttctgtttcgtgatgggcaaggtagtcatgtt
gaaatgacattaggttgccagcgcggcacgggttgcattgagttacgagaaatcgcagac
attcaattagaaacgtgcacagtactcaatcattctaatgaccacgcacagccaagcacc
actattcgccactgggtaagtttgatcaaaggcgatgaacaaggtcgaccacaagctcgt
attgaagagaaagagtatacagctcgaaatggtgacgaatatttcctcggagactgtttt
tcacattaa

DBGET integrated database retrieval system