KEGG   Vibrio cholerae IEC224: O3Y_17978Help
Entry
O3Y_17978         CDS       T01766                                 

Definition
(RefSeq) malate synthase (EC:2.3.3.9)
  KO
K01638  
malate synthase [EC:2.3.3.9]
Organism
vci  Vibrio cholerae IEC224
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vci00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    O3Y_17978
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    O3Y_17978
   00630 Glyoxylate and dicarboxylate metabolism
    O3Y_17978
Enzymes [BR:vci01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     O3Y_17978
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
Position
II:complement(905784..906362)
Genome map
AA seq 192 aa AA seqDB search
MNMLTFDKTEIQHQNKPFIAEAVFAVETVAANQQREKQTKAKQLLDRLFPLENGTHQDVT
AYVIDYNHLLAYFQDGRHSGLKYPKQFVAFNGSKENPSHLLFRDGQGSHVEMTLGCQRGT
GCIELREIADIQLETCTVLNHSNDHAQPSTTIRHWVSLIKGDEQGRPQARIEEKEYTARN
GDEYFLGDCFSH
NT seq 579 nt NT seq  +upstreamnt  +downstreamnt
atgaacatgctgacgtttgataaaacagaaatccaacaccaaaacaaaccctttatcgct
gaagctgtgttcgccgtagaaacggtcgccgccaatcaacagcgtgaaaaacaaaccaaa
gccaaacagttattggatcgtctgtttccgcttgaaaatggtactcaccaagatgtgacc
gcatacgtgatagattacaaccatctgctcgcttactttcaagatggacgtcatagtggc
ttgaaatacccaaaacagtttgtggcgtttaatggcagtaaagaaaatccaagccatctt
ctgtttcgtgatgggcaaggtagtcatgttgaaatgacattaggttgccagcgcggcacg
ggttgcattgagttacgagaaatcgcagacattcaattagaaacgtgcacagtactcaat
cattctaatgaccacgcacagccaagcaccactattcgccactgggtaagtttgatcaaa
ggcgatgaacaaggtcgaccacaagctcgtattgaagagaaagagtatacagctcgaaat
ggtgacgaatatttcctcggagactgtttttcacattaa

DBGET integrated database retrieval system