KEGG   Vibrio cholerae O395: VC0395_0282Help
Entry
VC0395_0282       CDS       T00520                                 

Definition
(RefSeq) malate synthase (EC:2.3.3.9)
  KO
K01638  
malate synthase [EC:2.3.3.9]
Organism
vco  Vibrio cholerae O395
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vco00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    VC0395_0282
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    VC0395_0282
   00630 Glyoxylate and dicarboxylate metabolism
    VC0395_0282
Enzymes [BR:vco01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     VC0395_0282
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
Position
1:318466..319074
Genome map
AA seq 202 aa AA seqDB search
MTLNLDEGTTMNMLTFDKTEIQHQNKPFIAEAVFAVETVAANQQREKQTKAKQLLDRLFP
LENGTHQDVTAYVIDYNHLLAYFQDGRHSGLKYPKQFVAFNGSKENPSHLLFRDGQGSHV
EMTLGCQRGTGCIELREIADIQLETCTVLNHSNDHAQPSTTIRHWVSLIKGDEQGRPQAR
IEEKEYTARNGDEYFLGDCFSH
NT seq 609 nt NT seq  +upstreamnt  +downstreamnt
atgacattgaatctggacgagggaacgacgatgaacatgctgacgtttgataaaacagaa
atccaacaccaaaacaaaccctttatcgctgaagctgtgttcgccgtagaaacggtcgcc
gccaatcaacagcgtgaaaaacaaaccaaagccaaacagttattggatcgtctgtttccg
cttgaaaatggtactcaccaagatgtgaccgcatacgtgatagattacaaccatctgctc
gcttactttcaagatggacgtcatagtggcttgaaatacccaaaacagtttgtggcgttt
aatggcagtaaagaaaatccaagccatcttctgtttcgtgatgggcaaggtagtcatgtt
gaaatgacattaggttgccagcgcggcacgggttgcattgagttacgagaaatcgcagac
attcaattagaaacgtgcacagtactcaatcattctaatgaccacgcacagccaagcacc
actattcgccactgggtaagtttgatcaaaggcgatgaacaaggtcgaccacaagctcgt
attgaagagaaagagtatacagctcgaaatggtgacgaatatttcctcggagactgtttt
tcacattaa

DBGET integrated database retrieval system