KEGG   Aiivibrio fischeri MJ11: VFMJ11_A0292Help
Entry
VFMJ11_A0292      CDS       T00754                                 

Definition
malate synthase
Orthology
K01638  
malate synthase [EC:2.3.3.9]
Organism
vfm  Aiivibrio fischeri MJ11
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vfm00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    VFMJ11_A0292
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    VFMJ11_A0292
   00630 Glyoxylate and dicarboxylate metabolism
    VFMJ11_A0292
Enzymes [BR:vfm01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     VFMJ11_A0292
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:complement(330971..331531)
Genome map
AA seq 186 aa AA seqDB search
MAITNINKESNTQQEAPFMAEAVYAVEKMEAKQEEKQHQIKGLLDQLFPLTKGSHQDVTN
YLLDYHHLVVFFKDGSCSGLRNPGKFVAFTGHRSSPDTILLKDNSGSHVEIIFGLHTPGK
DSLVTIADVEIETCTTFSQDFSLAAMRHWISLIKRDNSSHIKAHQVDKEYTAKNGDEYQL
NSCFSL
NT seq 561 nt NT seq  +upstreamnt  +downstreamnt
atggcgattaccaatataaacaaagaaagtaatacacaacaagaagctccgtttatggct
gaagctgtttacgccgtcgaaaaaatggaagcaaaacaagaggaaaagcaacatcaaatc
aaaggtcttcttgaccagttattcccattaacaaaaggttcacatcaagatgttactaac
tacttacttgattatcatcatttagtggttttctttaaagatggtagttgcagtggatta
cgtaatccaggaaaattcgtcgcttttacaggacacagatcatcgcctgatactattcta
ttaaaagataacagtggcagtcatgttgaaattatttttggtttgcatactccaggcaaa
gattcactggttaccatcgctgatgtagaaatagaaacatgcacaacatttagccaagac
tttagcttagcggctatgcgccattggattagtttaataaagcgtgataacagttcgcac
attaaagctcatcaagttgataaagaatatacagccaaaaatggagatgaataccaactt
aacagctgctttagtctctaa

DBGET integrated database retrieval system