KEGG   Vibrio fischeri MJ11: VFMJ11_A0292Help
Entry
VFMJ11_A0292      CDS       T00754                                 

Definition
malate synthase
Orthology
K01638  
malate synthase [EC:2.3.3.9]
Organism
vfm  Vibrio fischeri MJ11
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Class
Metabolism; Overview; Carbon metabolism [PATH:vfm01200]
Metabolism; Carbohydrate metabolism; Pyruvate metabolism [PATH:vfm00620]
Metabolism; Carbohydrate metabolism; Glyoxylate and dicarboxylate metabolism [PATH:vfm00630]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:complement(330971..331531)
Genome map
AA seq 186 aa AA seqDB search
MAITNINKESNTQQEAPFMAEAVYAVEKMEAKQEEKQHQIKGLLDQLFPLTKGSHQDVTN
YLLDYHHLVVFFKDGSCSGLRNPGKFVAFTGHRSSPDTILLKDNSGSHVEIIFGLHTPGK
DSLVTIADVEIETCTTFSQDFSLAAMRHWISLIKRDNSSHIKAHQVDKEYTAKNGDEYQL
NSCFSL
NT seq 561 nt NT seq  +upstreamnt  +downstreamnt
atggcgattaccaatataaacaaagaaagtaatacacaacaagaagctccgtttatggct
gaagctgtttacgccgtcgaaaaaatggaagcaaaacaagaggaaaagcaacatcaaatc
aaaggtcttcttgaccagttattcccattaacaaaaggttcacatcaagatgttactaac
tacttacttgattatcatcatttagtggttttctttaaagatggtagttgcagtggatta
cgtaatccaggaaaattcgtcgcttttacaggacacagatcatcgcctgatactattcta
ttaaaagataacagtggcagtcatgttgaaattatttttggtttgcatactccaggcaaa
gattcactggttaccatcgctgatgtagaaatagaaacatgcacaacatttagccaagac
tttagcttagcggctatgcgccattggattagtttaataaagcgtgataacagttcgcac
attaaagctcatcaagttgataaagaatatacagccaaaaatggagatgaataccaactt
aacagctgctttagtctctaa

DBGET integrated database retrieval system