KEGG   Aliivibrio salmonicida: VSAL_II0404Help
Entry
VSAL_II0404       CDS       T00782                                 

Definition
(RefSeq) malate synthase
  KO
K01638  
malate synthase [EC:2.3.3.9]
Organism
vsa  Aliivibrio salmonicida
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vsa00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    VSAL_II0404
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    VSAL_II0404
   00630 Glyoxylate and dicarboxylate metabolism
    VSAL_II0404
Enzymes [BR:vsa01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     VSAL_II0404
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
2:complement(454879..455442)
Genome map
AA seq 187 aa AA seqDB search
MAITTVNTTNNEQKETPFMAEAVFAVEEMNSNTNKDKQHEIKQLLDTLFPLAKGSHQDVT
NYLLDYHHLVVFFKDGGCSGLLNPGKFVAFTGHRSSPDRILLKDNSGSHVEIVFGHHESG
KNKLVTIDDIEMETCTTFSQDFSLAAMRYWISLLKRDDKSQPKARQEDKDYTAKNGGDYQ
LTSCFSL
NT seq 564 nt NT seq  +upstreamnt  +downstreamnt
atggctatcacaacagtaaacacgacgaataatgaacaaaaagaaactccgtttatggct
gaagccgtctttgccgtagaggaaatgaactcaaacacaaataaagataagcagcatgaa
ataaaacaattactcgatacgttgtttccattagcgaaaggatcacaccaagatgtgaca
aattacttattagactatcatcaccttgttgtgttttttaaagatgggggatgcagcgga
ttacttaacccagggaaatttgttgcatttaccggccaccgctcatcacctgatagaatt
ctattaaaagacaacagtggcagtcatgtagaaattgtttttggtcatcatgaatctggg
aaaaacaaactggtgacaattgatgatattgaaatggaaacctgcactacgtttagtcaa
gatttcagtttagcggcgatgcgttattggatcagtttattaaagcgagacgacaaatca
caaccaaaagcacgccaagaagacaaagattatacggctaaaaatgggggcgattaccaa
ctgaccagttgcttcagtttataa

DBGET integrated database retrieval system