KEGG   Vibrio splendidus: VS_II0268Help
Entry
VS_II0268         CDS       T00812                                 

Definition
(RefSeq) malate synthase
  KO
K01638  
malate synthase [EC:2.3.3.9]
Organism
vsp  Vibrio splendidus
Pathway
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vsp00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    VS_II0268
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    VS_II0268
   00630 Glyoxylate and dicarboxylate metabolism
    VS_II0268
Enzymes [BR:vsp01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.3  Acyl groups converted into alkyl groups on transfer
    2.3.3.9  malate synthase
     VS_II0268
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
2:310935..311507
Genome map
AA seq 190 aa AA seqDB search
MNMLTLDKTELHRNHSTFIAEAVFAVEMVKADKQLEKQKMAKQLLDTLFPLEAGSHEDAV
SYEIDYRHVQVYFKNGEHTGLKRAKHFVAYAGDKSKPSSILFRDESGTHVEVTIGARKGT
GNLELVNIEDIQLETCTTFGQTEANLSSGIRHWVSLVKGDESGRPSASSEDKEFTEKNGE
DYNLGFCFAI
NT seq 573 nt NT seq  +upstreamnt  +downstreamnt
atgaatatgctgacactagacaaaacagaacttcacagaaaccattcaacatttattgct
gaagctgtctttgccgtagaaatggtgaaagcagacaagcaactcgaaaaacaaaaaatg
gcgaaacagttgcttgatactctattccctttagaggcgggttcacacgaagatgcagtg
agctacgagattgattatcgacatgttcaggtttacttcaaaaacggcgagcacaccggc
ctgaaaagagcgaagcactttgtcgcttatgcgggtgataaatctaaaccatcgtcaatt
ctatttcgagacgagagcggtacccatgttgaagtgacgataggtgctcgcaaaggaact
ggtaatttagagttggtgaacatcgaagacattcaattagagacatgcaccacgtttggc
caaactgaagcgaacctctcttctggtattcgccactgggtgagcttagtgaagggtgat
gaaagcggccgaccaagcgcatcgagtgaagataaagagttcactgaaaagaatggcgaa
gattacaacctaggcttttgcttcgcgatttaa

DBGET integrated database retrieval system