KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00112Help
Entry
VVMO6_00112       CDS       T01415                                 

Definition
lysophospholipase L2 (EC:3.1.1.5)
Orthology
K01048  
lysophospholipase [EC:3.1.1.5]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Glycerophospholipid metabolism
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Lipid metabolism
   00564 Glycerophospholipid metabolism
    VVMO6_00112
Enzymes [BR:vvm01000]
 3. Hydrolases
  3.1  Acting on ester bonds
   3.1.1  Carboxylic-ester hydrolases
    3.1.1.5  lysophospholipase
     VVMO6_00112
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(124212..125210)
Genome map
AA seq 332 aa AA seqDB search
MVNNSSPLSYTQEALFEQAIGGPIAALWQQRQEGFLKTRDKMQLYWCKLTNPQHKKAVLV
VNGRIESAWKYQELLFDLYRQGYDVYSYDHRGQGLSDRLVKDSDIGHVYEFDDYILDMEA
VIAHFDFSSYQQRHIVSHSMGGAVATRYLQTHPQHGFDKLVLSAPMFGIDLPWYLSPVAM
AVSQILTAVYPTPTYAPGHKSYYEKPFEDNPLSQSQARYQWFRQLYRDKPELQVGGPSTR
WVWQGLMAAKQCILLTRQLTIPVLLLQAGGDRIVSNQAQSQFFKKLHKTNKRSEMVTIEG
AQHELLFEKDHYRNQALSAMFRFLQKEESNQA
NT seq 999 nt NT seq  +upstreamnt  +downstreamnt
atggttaataacagctcacctctctcttatacgcaagaggctttatttgagcaagcaata
ggtggtccgatcgctgccctatggcagcagcgacaagagggtttcctaaaaacgcgcgat
aagatgcagttgtattggtgtaagctgaccaacccgcaacacaaaaaggcggtgctggta
gtgaatggcagaatcgaatctgcttggaagtaccaagaacttctgtttgatctctaccgt
caaggctatgacgtctacagctacgatcatcgaggccaaggtttatcagatcgcctggtg
aaagactctgatattggtcacgtctacgagtttgatgattacattctcgacatggaagcc
gtgattgcgcactttgatttctcttcttatcagcagcgacacattgtttctcattcgatg
ggcggtgccgtcgccacgcgctacttacaaacccacccacaacatggttttgataagttg
gtgctcagtgcgccgatgtttggtatcgatctcccttggtatttaagtccagtggccatg
gcggtcagccaaattctcaccgccgtctacccaacgcctacttatgcgccgggacacaaa
agttattatgagaagccctttgaagataacccgctcagccagagccaagcgcgttatcaa
tggtttagacagttgtatcgcgacaagcccgagctgcaagtgggtggcccgagcacccgt
tgggtgtggcaaggcttaatggccgccaaacagtgcattttgctgacgcgccagctcacc
attccggtgttgctgttgcaggcagggggcgatcgcatcgtcagtaatcaagcacagtcg
cagtttttcaaaaagctgcacaaaaccaataagcgcagcgaaatggtgacgattgaaggc
gcgcaacatgaattgttgtttgagaaagaccactaccgtaatcaagcactcagcgcgatg
ttccgctttttgcagaaagaggaaagcaaccaagcttaa

DBGET integrated database retrieval system