KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00187Help
Entry
VVMO6_00187       CDS       T01415                                 

Definition
(GenBank) acetyl-coenzyme A synthetase
  KO
K01895  acetyl-CoA synthetase [EC:6.2.1.1]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
vvm00010  Glycolysis / Gluconeogenesis
vvm00620  Pyruvate metabolism
vvm00640  Propanoate metabolism
vvm00680  Methane metabolism
vvm01100  Metabolic pathways
vvm01110  Biosynthesis of secondary metabolites
vvm01120  Microbial metabolism in diverse environments
vvm01130  Biosynthesis of antibiotics
vvm01200  Carbon metabolism
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    VVMO6_00187
   00620 Pyruvate metabolism
    VVMO6_00187
   00640 Propanoate metabolism
    VVMO6_00187
  Energy metabolism
   00680 Methane metabolism
    VVMO6_00187
Enzymes [BR:vvm01000]
 6. Ligases
  6.2  Forming carbon-sulfur bonds
   6.2.1  Acid-thiol ligases
    6.2.1.1  acetate---CoA ligase
     VVMO6_00187
Lipid biosynthesis proteins [BR:vvm01004]
 Acyl-CoA synthetase
  Short/medium chain acyl-CoA synthetase
   VVMO6_00187
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADV85209
Position
I:complement(202576..204528)
Genome map
AA seq 650 aa AA seqDB search
MSEAHIYPVKENIKAHTHADNDTYLAMYQQSVTDPEGFWSEHGKIVDWIKPFTKVKQTSF
DTGHVDIRWFEDGTLNVSANCIDRHLAERGDDVAIIWEGDNPADDKTLTYNELYTEVCRF
SNALKEQGVRKGDVVCLYMPMVPEAAVAMLACTRIGAVHTIVFGGFSPEALAGRIIDSDA
KVVITADEGVRGGRAVPLKKNVDEALTNPEVKTISKVVVFKRTGGNIDWHEHRDVWWHEA
TAKVSDVCPPEEMKAEDPLFILYTSGSTGKPKGVLHTTGGYLVYATMTFKYVFDYQPGET
FWCTADVGWITGHTYLVYGPLANGAKTILFEGVPNYPNTSRMSEVVDKHQVNILYTAPTA
IRALMAKGNEAIEGTDRSSLRIMGSVGEPINPEAWEWYYKTIGNEKSPIVDTWWQTETGG
ILITPLPGATALKPGSATRPFFGVQPALVDNMGNVIEDQAAEGNLVILDSWPGQMRTVYG
DHERFEQTYFSTFKGMYFTGDGARRDEDGYYWITGRVDDVLNVSGHRMGTAEIESALVAH
PKIAEAAIVGIPHDIKGQAIYAYVTLNAGEYPTAELHKEVKDWVRKEIGPIATPDVLHWT
DALPKTRSGKIMRRILRKIATGDTSNLGDTSTLADPSVVDKLIAEKAELV
NT seq 1953 nt NT seq  +upstreamnt  +downstreamnt
atgagtgaagcccacatttatccggttaaagagaacatcaaagcccatacccatgcggat
aatgatacctacctagccatgtaccagcagtcagtcactgaccctgaaggtttctggagt
gaacacggcaaaattgttgactggattaagcccttcaccaaagtcaaacaaacgtctttt
gatactggccacgtagatattcgctggtttgaagatggcacgctcaacgtctcagcaaac
tgtattgaccgccatctagcagagcgcggcgatgatgtcgccatcatttgggaaggcgac
aacccagcggacgacaaaactctgacttacaacgagctctacaccgaagtgtgtcgtttc
tcgaatgcactcaaagagcaaggcgtacgcaaaggcgacgtggtgtgtctctacatgcca
atggtccctgaagcggcggttgcgatgttggcctgtacccgtattggtgcggtgcacacc
atcgtctttggtggtttttcaccagaagcactggctggccgcatcatcgactccgatgcc
aaagtcgtcatcacggccgacgaaggcgttcgtggtggtcgcgcggtgccactgaaaaag
aatgtggacgaagcactaaccaacccagaagtgaaaaccatcagcaaagtggtggtgttc
aagcgcactggcggcaacattgattggcacgaacatcgtgatgtttggtggcacgaagcg
acagcaaaagtctctgacgtttgcccaccagaagagatgaaagctgaagatccgctgttc
atcctctacacgtcaggctcaaccggcaaaccgaaaggcgtgctgcacaccacgggcggc
tatttggtctacgcgaccatgacctttaagtacgtgtttgactaccagccaggcgaaact
ttctggtgtacagccgacgtgggttggatcactggccacacgtatctggtttacggtcca
ctggcaaacggcgcgaaaaccattctctttgaaggcgtgccaaactatccaaacaccagc
cgcatgagtgaagtggtcgataagcaccaagtcaacattctttacaccgcaccaacggcc
attcgtgcgctgatggcaaaaggcaacgaagcgatcgaaggtacggatcgtagcagccta
cgcatcatgggctctgtgggtgaacctattaacccagaggcgtgggagtggtactacaaa
accatcggcaacgagaaatcaccgattgtcgatacttggtggcaaaccgaaactggcggc
attttgatcacaccactgccaggcgccaccgcgctgaaaccgggttctgcaacgcgccca
ttctttggtgttcagcctgcactggtggacaacatgggtaatgtgatcgaagaccaagcc
gcagaaggtaaccttgttatcctcgattcttggccaggtcaaatgcgcacggtttatggt
gaccacgagcgtttcgagcaaacctacttctcaacctttaaaggcatgtactttaccgga
gatggtgctcgacgcgatgaagatggttactactggatcacaggccgtgtggatgacgta
ttaaacgtttctggccaccgtatgggtacagcggaaattgaatccgccctagtggcccac
ccgaaaattgccgaagcagcgattgttggtattccacacgacatcaaaggccaagcaatt
tacgcctacgtcaccctcaatgcgggcgagtatccaaccgccgagctgcataaagaagtg
aaagattgggtacgtaaagagattggccctatcgcaacaccagacgtcctgcattggaca
gatgcactaccaaaaactcgttcaggtaaaatcatgcgccgcattttgcgcaagatcgcc
acgggagacaccagcaacttgggtgacacctcaacactggccgacccaagcgtagttgat
aagctgatcgcagaaaaagccgaactggtttaa

DBGET integrated database retrieval system