KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00358Help
Entry
VVMO6_00358       CDS       T01415                                 

Definition
UTP--glucose-1-phosphate uridylyltransferase (EC:2.7.7.9)
Orthology
K00963  
UTP--glucose-1-phosphate uridylyltransferase [EC:2.7.7.9]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Pentose and glucuronate interconversions
Galactose metabolism
Starch and sucrose metabolism
Amino sugar and nucleotide sugar metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Carbohydrate metabolism
   00040 Pentose and glucuronate interconversions
    VVMO6_00358
   00052 Galactose metabolism
    VVMO6_00358
   00500 Starch and sucrose metabolism
    VVMO6_00358
   00520 Amino sugar and nucleotide sugar metabolism
    VVMO6_00358
Enzymes [BR:vvm01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.7  Nucleotidyltransferases
    2.7.7.9  UTP---glucose-1-phosphate uridylyltransferase
     VVMO6_00358
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(403202..404074)
Genome map
AA seq 290 aa AA seqDB search
MIKKCLFPAAGYGTRFLPATKSMPKEMMPVVNKPLIEYGVEEAIQAGMDGMCIVTGRGKH
SIMDHFDKNYELEHQISGTNKEALLEDVRALIDSANFTYIRQREMKGLGHAILTGRELVG
DQPFAVVLADDLCVNEEQGVLAQMVALFKQFRCSIVAVQEVPENETHKYGVISGEMIKDD
LFRVDNMVEKPEPGTAPSNLAIIGRYILTPDIFDLIEQTEPGKGGEIQITDALLKQAKAG
CVLAYKFKGRRFDCGSVEGYIEATNYCYQNLYLKDEKTSELGKFSTQKEK
NT seq 873 nt NT seq  +upstreamnt  +downstreamnt
atgattaaaaaatgccttttccctgccgctggctacggcactcgcttcttacctgcgacc
aaatcgatgccaaaagaaatgatgccagtggtgaacaaacctctgatcgaatacggtgtg
gaggaagccatccaagcgggtatggacggaatgtgcattgttactggtcgtggtaagcat
tcaatcatggatcacttcgataaaaactacgaattagaacatcagattagtggtaccaac
aaagaagccctattggaagatgtacgtgctttgatcgactccgcgaactttacctacatt
cgccagcgtgagatgaagggcttagggcacgccatcttaacgggccgtgaactcgttggg
gatcaaccttttgccgtcgtactggctgatgacctttgtgtcaatgaagaacaaggtgtc
ttggcacaaatggtcgcgttgtttaagcagttccgctgttcgatcgttgctgttcaggaa
gtacctgaaaatgaaactcataaatacggcgtgatctctggcgaaatgatcaaagacgat
ctcttccgcgtagacaacatggtggagaagccagaacctggtaccgcgccaagtaatctt
gcaattattggtcgttacattcttaccccagatatttttgatctgattgagcaaactgaa
ccaggtaaaggcggggaaattcaaatcaccgacgcactactcaaacaagcaaaagcaggt
tgtgtattggcatataagtttaaaggtcgtcgttttgattgcggcagcgttgaaggctat
atcgaagcaaccaactattgctaccaaaacctttatctgaaagatgagaagacgtctgaa
ttgggtaaattcagtacgcaaaaagagaagtaa

DBGET integrated database retrieval system