KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00589Help
Entry
VVMO6_00589       CDS       T01415                                 

Definition
dihydropteroate synthase (EC:2.5.1.15)
Orthology
K00796  
dihydropteroate synthase [EC:2.5.1.15]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Folate biosynthesis
Metabolic pathways
Module
Tetrahydrofolate biosynthesis, GTP => THF
Class
Metabolism; Metabolism of cofactors and vitamins; Folate biosynthesis [PATH:vvm00790]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:666385..667215
Genome map
AA seq 276 aa AA seqDB search
MILRSQKKSLDLSFPVVMGILNVTPDSFSDGGQFNALDAALAQAERMIAAGVSIIDVGGE
STRPGAPEVSLEEELKRVIPAIQAIRQKHDVWISIDTSKAEVMKQAIEAGADLINDVRAL
QEPGALAVAAKAQVPICLMHMQGQPRSMQHNPSYQDVLKEVSEFLEERVAACEEAGIAKE
LLILDPGFGFGKTIEHNYHLLAHLEAFHQLGLPILAGMSRKSMVFKLLNKKPAECMVASV
TCATIAAMKGAQIIRVHDVEETVEAMRVIQMMHKNI
NT seq 831 nt NT seq  +upstreamnt  +downstreamnt
atgattctacgttctcaaaaaaaatccttagatctttcattccctgttgtgatgggaatt
cttaatgtcacacctgactcgttttccgatggaggccaatttaatgcgcttgatgcggca
ttggcccaagccgagcgaatgattgctgccggtgtgagtatcattgatgtcggtggtgag
tcaacacgtccaggtgcgccagaagtctcattggaagaagagttgaagcgcgttattcct
gcaattcaagccattcggcaaaagcacgatgtttggatctctattgataccagcaaagcg
gaagtgatgaagcaagccattgaagccggtgcggatctcattaatgatgttcgcgcattg
caggagccaggggccttggcagttgccgcgaaagcccaagttccgatttgtctgatgcac
atgcaaggccaacctcgaagcatgcagcataacccaagctatcaagatgtattaaaagag
gtcagcgaatttttggaagagcgtgttgcagcctgtgaagaagccggtattgcaaaagag
ctgcttattcttgaccctgggtttggttttggcaaaaccatcgaacacaattatcatctg
ttagcgcatttagaggcatttcatcaattaggtttgccgattttggcgggcatgtctcgt
aaatcgatggtttttaaattactgaacaaaaagcctgcagagtgcatggtggctagtgta
acatgtgcgacgattgctgctatgaaaggcgctcagatcattcgcgttcatgatgtcgaa
gaaaccgttgaagcgatgcgagtcattcaaatgatgcataaaaatatctga

DBGET integrated database retrieval system