KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00623Help
Entry
VVMO6_00623       CDS       T01415                                 

Definition
thymidine phosphorylase (EC:2.4.2.4)
Orthology
K00758  
thymidine phosphorylase [EC:2.4.2.4]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Pyrimidine metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Nucleotide metabolism
   00240 Pyrimidine metabolism
    VVMO6_00623
Enzymes [BR:vvm01000]
 2. Transferases
  2.4  Glycosyltransferases
   2.4.2  Pentosyltransferases
    2.4.2.4  thymidine phosphorylase
     VVMO6_00623
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:704287..705615
Genome map
AA seq 442 aa AA seqDB search
MYLPQEIIRKKRDGEALTADEINFFIQGVANNTVSEGQIAAFAMTIFFNEMTMPERIALT
CAMRDSGMVIDWSHMNFGGPIVDKHSTGGVGDVTSLMLGPMVAACGGFVPMISGRGLGHT
GGTLDKLEAIPGYNITPSNDVFGQVTKEAGVAIIGQTGDLAPADKRVYATRDITATVDNI
SLITASILSKKLAAGLESLVMDVKVGSGAFMPTYEASEELAKSIVAVANGAGTKTTAILT
DMNQVLASSAGNAVEVREAVRFLKGEYRNPRLLEVTMASCAEMLVLGKLAENTEDARAKL
MEVLDNGKAAECFGKMVAGLGGPVDFMDNYDNYLDKAEIIKPVYAKETGVVSAMDTRAIG
MAVVAMGGGRRVATDSIDYAVGFDQFIRLGEIASSEKPLAMIHARNEAQWQEAANALQAA
IKVGGEYTPTPDVYRQIRQEDI
NT seq 1329 nt NT seq  +upstreamnt  +downstreamnt
atgtatttacctcaagaaattattcgtaaaaaacgcgacggcgaagcactgactgccgac
gaaattaacttttttatccaaggtgtggcgaacaatacggtctctgaaggtcagattgcc
gcgtttgcgatgaccatctttttcaatgaaatgacgatgcctgaacgtattgccctaacg
tgtgcaatgcgagattctggcatggtgattgattggagccacatgaactttggtggccca
atcgttgataaacactcaaccggcggtgtgggcgatgtgacctctctaatgcttggccct
atggtggcagcatgtggtggtttcgtgccgatgatctcgggtcgtggcctgggccatact
ggcggtacgttagacaaattggaagcgattcctggctacaacatcacaccaagtaacgac
gtattcggtcaagtgaccaaagaagcaggcgtggcgatcatcggccaaacgggcgatctt
gcaccagcagacaaacgagtctatgccactcgtgatattacggcgacggtggacaacatc
tcactgatcaccgcttccattctgtctaagaagttggcggcaggtcttgaatctttagtg
atggatgtgaaagtcggttcgggcgcctttatgccgacttacgaagcttcagaagaattg
gcgaaatccattgtggcggtggcgaatggcgcgggcactaagacgacggcgattttgacc
gacatgaaccaagtattggcttcttctgcgggtaacgctgttgaagttcgtgaagcggtt
cgtttcctcaaaggtgaatatcgtaaccctcgtttgcttgaagtcacgatggcgtcatgt
gctgaaatgttggtacttggtaaattggctgagaataccgaagacgcacgtgcgaaattg
atggaagtactggataacggtaaagcggcagaatgctttggtaagatggtggcaggtttg
ggtggtccggttgactttatggacaactacgacaactacctcgataaagctgaaatcatt
aagcctgtttacgccaaagagaccggcgtggtgtctgcaatggatactcgcgctattggt
atggctgtggtggcgatgggcggtggacgccgcgttgcgacggacagcatcgattacgcg
gtaggttttgatcagtttatccgtttgggcgaaatcgcaagcagcgaaaaaccactggcg
atgattcacgctcgtaacgaagcgcagtggcaagaagctgcgaatgcactacaagcagcg
attaaggtgggtggtgagtacacaccaacaccagacgtatatcgtcaaattcgccaagaa
gatatttaa

DBGET integrated database retrieval system