KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00666Help
Entry
VVMO6_00666       CDS       T01415                                 

Definition
aldose 1-epimerase (EC:5.1.3.3)
Orthology
K01785  
aldose 1-epimerase [EC:5.1.3.3]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Glycolysis / Gluconeogenesis
Galactose metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Module
Galactose degradation, Leloir pathway, galactose => alpha-D-glucose-1P
Class
Metabolism; Carbohydrate metabolism; Glycolysis / Gluconeogenesis [PATH:vvm00010]
Metabolism; Carbohydrate metabolism; Galactose metabolism [PATH:vvm00052]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:755660..756718
Genome map
AA seq 352 aa AA seqDB search
MIAQLNQTMTEQAAFDGQPAQLVELSNRAGMSVTLMDIGATWLSCQLPLASGERREVLLG
VGTMQNFERQASYMGVTVGRYANRIANGLFSIDDVAYQVSVNQAGNCLHGGAQGFDKRRW
HIESQSSSEVTFSLESPNGDQGFPGHLSVNVQYQLTDENQLTIRYWATTDAVTPVNLTNH
AYFNLMGAESGHDCLQHKLVLNAPCYLPTNDVGIPLGTLRRVSGTSFDFNTEKAIGEVLL
QDEQQQCAKGYDHSYLFERERDVSLPVACVTSPDELIRLSVCTNKPAIQLYTGNWLAGTP
NRSGSEYRDYAGLALETQFLPDSPNHPDWPQPSCLLSPGEEYRYFTSYHFDF
NT seq 1059 nt NT seq  +upstreamnt  +downstreamnt
atgattgctcaattgaaccaaactatgactgagcaggcagcctttgatggccagcctgcc
caattagtggaactgtcaaatcgtgcgggtatgtctgtgaccttaatggacattggcgcg
acttggctaagttgccaattaccgttggcgagcggggagcgaagagaagttctgttaggc
gtggggacgatgcagaacttcgagcgtcaggcaagttacatgggggtaaccgtcgggcgt
tatgcaaatcgcatcgccaatgggcttttttcgattgatgatgtggcgtaccaagtttcg
gtaaaccaagcggggaactgtttgcatggtggagcgcaaggttttgataaacgacgttgg
catattgaatcgcaatcaagtagcgaagtgaccttttcactcgaatctccaaatggcgat
caggggtttcccggccatcttagcgttaacgtgcagtatcagttgaccgacgagaatcaa
ctgaccattcgttactgggcaacaaccgatgccgtgacgccagtgaatctcactaaccat
gcgtatttcaatctaatgggggcggaatcggggcatgattgcttgcagcacaagttggta
ttaaatgccccgtgctatttgccgaccaatgacgttggcattccattgggtacgctgcga
agggtttctggcaccagttttgatttcaatactgaaaaagccattggtgaagttttgcta
caagatgagcagcaacaatgtgccaaagggtatgatcacagctatttgtttgaacgagag
cgcgatgtgtctctgcccgttgcgtgtgtgacctcgcctgatgagttgattcgtttgtct
gtgtgtaccaacaaacccgccattcagctctatacgggtaattggctggcaggcacacca
aaccgcagtggcagtgaatatcgagactacgcaggattggcgctggagacccaatttttg
ccagattcgccgaaccatccagattggccacaacccagttgcctgctttctcctggcgaa
gaatatcgttactttacctcctatcattttgatttttag

DBGET integrated database retrieval system