KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00752Help
Entry
VVMO6_00752       CDS       T01415                                 

Definition
1-deoxy-D-xylulose 5-phosphate reductoisomerase (EC:1.1.1.267)
Orthology
K00099  
1-deoxy-D-xylulose-5-phosphate reductoisomerase [EC:1.1.1.267]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Terpenoid backbone biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Metabolism of terpenoids and polyketides
   00900 Terpenoid backbone biosynthesis
    VVMO6_00752
Enzymes [BR:vvm01000]
 1. Oxidoreductases
  1.1  Acting on the CH-OH group of donors
   1.1.1  With NAD+ or NADP+ as acceptor
    1.1.1.267  1-deoxy-D-xylulose-5-phosphate reductoisomerase
     VVMO6_00752
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:846734..847942
Genome map
AA seq 402 aa AA seqDB search
MQKLTILGATGSIGASTLKVIEQNPDKFSVVALAADSNVEKMQQLCQRWQPEFAVMANKE
AALRLKMALAVLAPNTQVLGGQEALCYVATLEQVDSVMAAIVGAAGLVPTMAAVKAGKRI
LLANKEALVMSGQLFIDEVEKSGAQLLPVDSEHNAIFQCLPQAVQGNLGRCDLASQGVSH
ILLTGSGGPFRYTDVAELEAVTPEQAIAHPNWSMGPKISVDSATMMNKGLEYIEAKWLFN
ANRDQLKVIIHPQSVIHSMVQYLDGSVLAQMGEPDMATPIALTLSYPERVKAGVKPLDFT
QVGELTFLQPDFERYPCLALAIEACYLGQHATTTLNAANEVAVAAFLARQIKFTDIARVN
DSVLNQVCKQSLASGLDSLESLLELDRMARTLADEVVRERAQ
NT seq 1209 nt NT seq  +upstreamnt  +downstreamnt
atgcaaaagctaacgattctaggtgcaacaggctcaattggtgcaagcactctaaaagtc
attgaacaaaacccagataagttttctgtggttgccttggctgcagattcaaatgtggag
aaaatgcagcaactttgccaacgatggcagccggaattcgcggttatggccaataaagaa
gctgcgctgcgtctgaaaatggcgcttgccgtcttggctcccaacacacaagttcttggt
ggacaagaagcactttgctatgtcgctacgcttgagcaggtagacagcgtgatggccgcg
attgttggagcggcaggtctagtccctaccatggcggcagttaaagcaggcaaacgtatt
ttgctggcgaataaagaagccttagttatgtctgggcaactgtttattgatgaagtcgaa
aaatcaggcgctcagttgttgcctgtggacagtgaacataacgccatttttcaatgttta
cctcaagccgttcagggcaaccttggtcgctgtgacttagcgtctcaaggggtgagtcat
attctattgaccggttctggtgggccgtttcgttacactgatgtggccgaactagaagcc
gtgacaccagagcaggcgattgctcatcctaactggtctatggggccaaaaatttcggtt
gactctgcgacgatgatgaataaaggcttagagtatatcgaagccaaatggttatttaat
gccaacagagatcagcttaaagtgatcattcatccccagtcagtgatccattcgatggtg
caatatctcgatggctcggtgttggctcagatgggtgagccagatatggcgacgccgatt
gcgttaaccctgtcttaccctgaacgcgttaaagcgggtgtgaaaccgttggatttcacg
caagttggcgaactcactttcctacaacctgatttcgaacgttacccgtgtttggcacta
gcgattgaggcgtgttacttaggtcagcatgcgacaacgacgcttaatgctgccaatgaa
gtggcggtggcggcatttcttgctcgccaaattaaatttacagatatcgcacgggtgaat
gactcagttttaaaccaagtatgtaaacagtcgttagcatccggcctagatagcttggaa
agcttattagagctcgatagaatggcaagaacattagccgatgaagttgttagagagcgt
gcacaatga

DBGET integrated database retrieval system