KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00783Help
Entry
VVMO6_00783       CDS       T01415                                 

Definition
phosphoribosylglycinamide formyltransferase (EC:2.1.2.2)
Orthology
K11175  
phosphoribosylglycinamide formyltransferase 1 [EC:2.1.2.2]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Purine metabolism
One carbon pool by folate
Metabolic pathways
Biosynthesis of secondary metabolites
Module
Inosine monophosphate biosynthesis, PRPP + glutamine => IMP
Class
Metabolism; Nucleotide metabolism; Purine metabolism [PATH:vvm00230]
Metabolism; Metabolism of cofactors and vitamins; One carbon pool by folate [PATH:vvm00670]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(880176..880814)
Genome map
AA seq 212 aa AA seqDB search
MKKIVVLISGSGSNLQAILEACECDTSRAKVCAVFSNKADAYGLERAKQFSVPAHYIDPK
AFTDRESFDRELMKAIDEYQPDIVVLAGYMRILSGEFVRHYLGKMVNIHPSLLPKYPGLH
THQRAIDAGDSEHGTSVHFVTEELDGGPVILQAKVPIFAEDDAQSLAERVLTQEHSIYPL
VVKWMAEERLVMQQGVAYLDGQPLGSAGYAAE
NT seq 639 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaaatcgtggtactgatttccggcagcggcagcaacctgcaagccattcttgaa
gcatgcgagtgtgatacaagccgagccaaagtgtgtgcggttttctcaaacaaagccgac
gcttacggtcttgaacgagccaaacagttttcggtacccgctcattacatcgatcccaag
gcgtttaccgatagagaaagttttgatcgtgaattgatgaaagcgatagacgaataccaa
cccgacatcgtagtactggctggttacatgcgcattctgagtggtgaatttgtacgtcac
tatttaggaaaaatggtcaatatacatccttccctcttgcctaaataccccggccttcat
acccaccagcgcgccatcgatgcaggggacagtgaacacggcaccagtgtgcattttgtc
acggaagaattagatgggggcccagtgatcttacaggcgaaagtacctattttcgcagaa
gatgacgcacaaagcctagcggagcgcgtgttaacgcaagagcacagcatctatccctta
gtggtgaaatggatggcagaagagcggcttgtcatgcaacaaggtgttgcctatctcgat
ggccaaccacttggcagcgccggttacgctgcagagtaa

DBGET integrated database retrieval system