KEGG   Vibrio vulnificus MO6-24/O: VVMO6_00899Help
Entry
VVMO6_00899       CDS       T01415                                 

Definition
alkaline phosphatase (EC:3.1.3.1)
Orthology
K01077  
alkaline phosphatase [EC:3.1.3.1]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Aminobenzoate degradation
Folate biosynthesis
Metabolic pathways
Microbial metabolism in diverse environments
Two-component system
Module
Tetrahydrofolate biosynthesis, GTP => THF
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Metabolism of cofactors and vitamins
   00790 Folate biosynthesis
    VVMO6_00899
  Xenobiotics biodegradation and metabolism
   00627 Aminobenzoate degradation
    VVMO6_00899
 Environmental Information Processing
  Signal transduction
   02020 Two-component system
    VVMO6_00899
Enzymes [BR:vvm01000]
 3. Hydrolases
  3.1  Acting on ester bonds
   3.1.3  Phosphoric-monoester hydrolases
    3.1.3.1  alkaline phosphatase
     VVMO6_00899
Exosome [BR:vvm04147]
 Exosomal proteins
  Exosomal proteins of other body fluids (saliva and urine)
   VVMO6_00899
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(995530..997107)
Genome map
AA seq 525 aa AA seqDB search
MKHLIKPVVAVVATSTLSFNALSAEIKNVILMIGDGMGPQQVGLLETYANNAPNSIYQGK
TTALYTLAQEGVIGSSLTHPEDAIVVDSACSATMLATGIMTGSEVIGIDSQGNSVETVLE
KAKRMGKATGIISDTRMTHATPAAFAAHQPHRSLENEIAADMLATDVDVLLSGGLRHWIP
KSANDKGEIYQQLQALTQGDVALKSKRKDDRNLLTEAQQAGYSLAFNKAMLEQAQGTKLL
GLFANSAMYDGITYSQTKGDAERKEPTLAEMTSKALDILAKDKDGFFLMVEGGQIDWAGH
SNDAGSMLHEMIKFDEAINTVYQWAKDRDDTLIIVTADHETGSFGFSYSGYNLPKPEKRP
GKAFENRDYAPNFNFGAFDILDGLYNQKTSYYGMLSAFEKLDKNQQTAAKLAEIINKNSD
FSITAGQAENILKNKPNPYRLANHSYLAEETVPAINDFDAFFPYNDRTNLIAREQATKQN
IVWGTGTHTHTPVNVFAWGPAETILPVSRILHHSELGEFIKNQVK
NT seq 1578 nt NT seq  +upstreamnt  +downstreamnt
atgaagcacctgatcaaacccgttgttgccgttgtagcaacttctacgctctcttttaat
gcactttctgcagaaattaaaaacgtcattttgatgattggtgatggcatggggccacaa
caagttggcctattggaaacctacgccaacaacgcgccaaattccatctaccaaggcaaa
accaccgcactttacactcttgctcaagaaggcgttattggctcatcgctgacgcatcca
gaagacgcgattgtggtggattcagcctgttctgccaccatgctggcgaccggcatcatg
acaggttcagaagtgatcggcatcgattcgcaagggaacagcgtcgaaactgtactcgaa
aaagccaaacgtatgggcaaagccaccggcatcatttccgacactcgcatgacgcacgcc
actcctgctgcctttgccgcccaccaacctcatcgctcattggaaaatgaaattgccgcc
gacatgctcgctaccgatgtcgatgtgctgctgtctggtggtttgcgtcattggattcca
aagtcggcaaacgacaaaggtgaaatctatcaacagttacaagccctaactcaaggtgac
gttgcattaaaatcaaaacgcaaagacgatcgcaacttgctgacggaagcgcaacaagcg
ggttactctctggcatttaataaagccatgctagagcaagcgcaagggacgaaactactg
ggtctttttgctaactcagccatgtacgatggcatcacctacagccaaaccaaaggtgac
gcagagcgcaaagaaccaacactggcagaaatgaccagcaaagccttggatatcctagcc
aaggacaaagacggtttcttcttgatggttgaaggcggacaaatcgactgggctggccac
agcaatgatgccggttcaatgctgcatgaaatgatcaagtttgatgaagcgattaatacg
gtttaccaatgggctaaagatcgtgatgacactttgattattgtcacggcggaccacgaa
accggctcttttggctttagctactcaggctataatctgccaaaaccagagaaacgtccg
ggaaaagcattcgaaaatcgtgattatgcgccgaactttaactttggtgctttcgatatt
ctcgatggtttgtacaaccaaaaaaccagctactatggcatgcttagtgcgtttgaaaag
ttggataaaaaccaacaaaccgcggcaaaactagcagaaatcatcaataagaatagtgat
ttttcgattaccgcaggccaagctgaaaacatcctgaaaaacaaacccaatccatatcgt
ttggccaaccacagctatcttgctgaggaaaccgtgccagccattaacgactttgatgcg
tttttcccatacaacgacagaaccaacctgatcgctcgtgagcaagcgactaagcaaaat
atcgtctgggggacaggcacacacacccatacaccagtgaatgtttttgcttggggacct
gcagaaaccattctccctgtgtcacgcattttgcaccactctgagttgggcgagttcatt
aaaaatcaggtgaaataa

DBGET integrated database retrieval system