KEGG   Vibrio vulnificus MO6-24/O: VVMO6_01026Help
Entry
VVMO6_01026       CDS       T01415                                 

Definition
Holliday junction DNA helicase RuvA
Orthology
K03550  
holliday junction DNA helicase RuvA [EC:3.6.4.12]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Homologous recombination
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Genetic Information Processing
  Replication and repair
   03440 Homologous recombination
    VVMO6_01026
Enzymes [BR:vvm01000]
 3. Hydrolases
  3.6  Acting on acid anhydrides
   3.6.4  Acting on acid anhydrides to facilitate cellular and subcellular movement
    3.6.4.12  DNA helicase
     VVMO6_01026
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:1149738..1150352
Genome map
AA seq 204 aa AA seqDB search
MIGRLRGILLEKQPPELLIEVNGIGYEVQMPMSCFYELPNIGEEAIIYTHFVVREDAQLL
YGFNTVKERALFREVIKANGVGPKLGLAILSGMTASQFVASVEREDISTLVKLPGVGKKT
AERLVVEMKDRLKGWSAGDLFTPFTDAAPVDSGSTSSNSAEEEAVSALLALGYKPVQASK
VVSQIAKPDMTSEQLIREALKSMV
NT seq 615 nt NT seq  +upstreamnt  +downstreamnt
gtgatcggacgtcttcgcggcattctgctggaaaaacaaccccctgaattgttgattgaa
gttaatggcattggctatgaagttcagatgccaatgagttgtttctacgagcttcctaac
attggggaagaagccattatctatactcattttgtggtgcgtgaagatgctcagttactt
tatggattcaataccgtgaaagaacgagcgctgtttagagaagtcatcaaagccaatggg
gttggaccaaaactgggtttggccattttatcaggcatgacggcaagccagtttgtggcg
tcggtagaaagagaagacatttccacgctggtgaaattaccgggcgttggcaagaagacc
gcagaacgtcttgtggttgagatgaaagatcgtttgaaaggttggagtgctggcgatctg
ttcacgccgtttaccgatgcggcgccagttgattcaggcagcacaagcagtaacagcgca
gaagaagaagcggtcagtgcgctcttggcgttgggatataagcctgttcaggcatcaaaa
gtagtatcgcagattgctaaaccggatatgaccagcgaacagttgatccgtgaagcgctc
aagtccatggtctaa

DBGET integrated database retrieval system