KEGG   Vibrio vulnificus MO6-24/O: VVMO6_01069Help
Entry
VVMO6_01069       CDS       T01415                                 

Definition
L-fucose isomerase (EC:5.3.1.25)
Orthology
K01818  
L-fucose isomerase [EC:5.3.1.25]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Fructose and mannose metabolism
Microbial metabolism in diverse environments
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Carbohydrate metabolism
   00051 Fructose and mannose metabolism
    VVMO6_01069
Enzymes [BR:vvm01000]
 5. Isomerases
  5.3  Intramolecular oxidoreductases
   5.3.1  Interconverting aldoses and ketoses, and related compounds
    5.3.1.25  L-fucose isomerase
     VVMO6_01069
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:1192652..1194400
Genome map
AA seq 582 aa AA seqDB search
MSNLVKIGIRPTIDGRRLGVRESLEEQTMNMAKNLANFIAENVRHVSGEAVECVIADSTI
GGVAEAAACADKFKRENVGLSITVTPCWCYGTETIDMDPHMPKAIWGFNGTERPGAVYLA
AAMAGHSQVGLPAFSIYGEEVQDKDDTSIPSDVQEKILRFCRAGLTVATIRGKSYLSMGS
VSMGIAGSIVDQPFFQHYLGMRNEYVDMTEIKRRLDREIFDKEEFELAMAWTKEHCHEGK
DYNREPMSEARKQEDWQTVVKMTMIMRDLMEGNPKLAEMGFGEEALGHNAVVGGFQGQRH
WTDHLPNGDFSEAILNSSFDWNGIREPFVIATENDSLNGVNMLFGKMLTGQAQVFCDVRT
YWSADSVERVSGYRPESGFIHLVNSGSAALDGCGEAKLTSGESAIKPHWQMSAQDAEACL
SATKWPPADVEYFRGGGFSSNFLTHGGMPFTMHRINIIKGIGPVLQIAEGHSITLPQEVH
ETLNERTNPTWPTTWFVPRLNGEGAFKDVYSVMANWGANHCVITYGHVGADLITLASMLR
IPVAMHNVEESDVFRPHTWSAFGQDKEGQDYRACATFGPLYK
NT seq 1749 nt NT seq  +upstreamnt  +downstreamnt
atgagtaatttagtcaaaatcggtattcgcccaacaattgatggccgtcgtttaggtgtg
cgtgagtctctagaagagcaaaccatgaacatggcgaaaaatttagccaactttatcgct
gaaaatgtccgtcatgttagcggcgaagcggtcgaatgtgtgattgcagattcaaccatc
ggcggtgtagcagaagcagccgcgtgtgcggataagttcaagcgcgaaaatgttggtctc
tctatcactgtcacaccttgctggtgttacggcacggagacgattgatatggacccacat
atgcccaaagcgatttggggctttaatggcactgaacgtccgggagcagtttacttagcc
gcagcgatggcgggtcactcccaagttggtctccctgcgttctcaatctatggtgaggaa
gtgcaagataaagacgacacttctattccatctgacgtacaagagaagatcttgcgtttc
tgccgcgccggtctgacggtggcgacgattcgcggtaaatcttacctatccatgggttcg
gtctctatgggtatcgcaggctcgattgttgatcaacccttcttccagcactacctaggt
atgcgtaatgaatacgtggatatgacggaaatcaaacgccgcctagaccgagagatcttc
gataaagaagagttcgagttagcgatggcgtggacgaaagagcattgccatgaaggtaaa
gattacaaccgtgagccaatgagtgaagcgcgtaaacaggaagattggcagacagtggtt
aagatgacgatgatcatgcgcgatctgatggaaggtaaccctaaactggcggaaatgggc
ttcggtgaagaagcactcggtcataacgccgtcgtgggaggcttccaaggccagcgtcat
tggacagaccatctgccaaatggtgactttagtgaagcgatccttaactcttcgtttgac
tggaatggcattcgtgaaccgtttgtgattgcgactgaaaacgacagcctcaatggcgtt
aacatgctgtttggcaagatgttgacaggtcaagcgcaagtgttctgcgatgttcgtact
tactggtcagcagactcggttgaacgcgtcagtggctaccgcccagaatccggcttcatc
cacctagttaactcaggttctgctgcgcttgatggttgtggcgaagctaagttaaccagt
ggcgagtccgccatcaaaccgcactggcagatgagcgcgcaagatgcagaggcatgcctt
agcgccaccaaatggccaccagcagatgttgaatacttccgtggcggcggtttctcttcg
aatttcctaacccatggcggcatgccatttaccatgcaccgcatcaacatcattaagggg
attggtccggttctacaaatcgcagaaggtcactcaattacgctgccgcaagaggtgcat
gaaactcttaatgagcgtaccaacccaacttggccgaccacatggtttgtgccgcgctta
aatggcgaaggagcattcaaagatgtttattcggtgatggcgaactggggcgcgaaccac
tgtgtgatcacttatggtcacgttggggctgatttgatcaccctcgcgtcgatgctgcgc
attcctgttgcgatgcacaacgtggaagagagtgacgtgttcagacctcacacctggagt
gcattcggtcaagacaaagaaggccaagattaccgcgcttgtgcaacctttggtcctttg
tacaaataa

DBGET integrated database retrieval system