KEGG   Vibrio vulnificus MO6-24/O: VVMO6_01072Help
Entry
VVMO6_01072       CDS       T01415                                 

Definition
L-fuculose phosphate aldolase (EC:4.1.2.17)
Orthology
K01628  
L-fuculose-phosphate aldolase [EC:4.1.2.17]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Fructose and mannose metabolism
Class
Metabolism; Carbohydrate metabolism; Fructose and mannose metabolism [PATH:vvm00051]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:1196347..1196994
Genome map
AA seq 215 aa AA seqDB search
MNRVELSQQIIDTCLEMTRLGLNQGTAGNVSVRFDNGMLITPTGIPYEKLTPDHIVYVAQ
DGSFEEGKLPSSEWLFHLTCYQQRDDINAVVHNHAINCAAVSILNKSIPAIHYMVAASGA
TEIPCVPYATFGSSKLAQFVEEGIAKSKAILLQHHGLIAGEVNLEKALWLAHEVEVLADL
YLKTLAITPDVPVLDEASMAVVLDKFKSYGLRVEK
NT seq 648 nt NT seq  +upstreamnt  +downstreamnt
atgaatcgagtagaactatcacaacaaatcatcgacacttgtcttgaaatgactcgtctt
ggcctaaaccaaggcacagcaggtaacgttagcgtgcgttttgacaacggcatgctgatt
actccaactggtattccgtatgaaaaactcactcctgatcatattgtgtacgtggcgcag
gatggcagctttgaagagggcaaattgccatcatcagagtggctgttccacttaacttgt
taccagcagcgtgatgatattaacgctgtggtgcacaatcacgcgatcaactgtgcagca
gtttctatcctgaataaatccattccagccattcattatatggttgcggcatcgggtgcg
actgaaatcccatgtgtcccttatgcgacgttcggcagctctaaactggcgcaattcgtg
gaagagggcattgcgaaaagtaaagcgatcttgcttcaacatcacggtctaatcgcaggt
gaagtgaatttagaaaaagccttgtggttagcgcatgaggtggaagtgttggccgatctc
tatctaaaaacgcttgcaataacaccggatgttcccgtgttagatgaagcgtcgatggcc
gtggtactggacaagtttaagtcttacggcttgcgtgtagagaaatag

DBGET integrated database retrieval system