KEGG   Vibrio vulnificus MO6-24/O: VVMO6_01254Help
Entry
VVMO6_01254       CDS       T01415                                 

Definition
nicotinamidase (EC:3.5.1.19)
Orthology
K08281  
nicotinamidase/pyrazinamidase [EC:3.5.1.19 3.5.1.-]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Nicotinate and nicotinamide metabolism
Metabolic pathways
Class
Metabolism; Metabolism of cofactors and vitamins; Nicotinate and nicotinamide metabolism [PATH:vvm00760]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:1406225..1406869
Genome map
AA seq 214 aa AA seqDB search
MVDIFKNRTASLDVDPQQGFSELCPNELPVSGALEIVEALKQNHTKAKLKLVSRDMHPPG
AAWEAETPANMLEPVGLPEVDIKWNPHCIVGTQGVELLPGLPAIREYDFQMNKGIDPDAH
PYGAFYHDQADTLSTGGIEFLRAHRIDTVLVGGLALDFCVKKSIEQLVAADFKVILNLAS
TRAVFPENNPQVVSHLTALGVICIDDVNQLQLHE
NT seq 645 nt NT seq  +upstreamnt  +downstreamnt
atggtagatatctttaaaaatcgcacagcgtcgttagacgtggatccgcaacaagggttt
agtgagttatgccccaatgaacttcctgtctccggtgcgttagagattgttgaagcgtta
aagcagaatcatacaaaagcaaagctgaagttagtgtcgcgcgatatgcatcctccggga
gctgcgtgggaagctgaaacgcctgcaaacatgttagagccggttggccttccggaagtg
gatattaaatggaatccacattgtattgtcggtacgcaaggtgtcgaattgcttccgggc
ttacccgctattcgagagtacgatttccaaatgaacaaaggtattgatcccgatgcccac
ccatacggggcgttttatcatgaccaagccgatacgctatcgacagggggaattgagttc
cttcgtgcccacagaatagatactgtgcttgtgggtggattggcgttggacttttgcgtg
aaaaaatccattgaacagcttgtcgccgcagactttaaggtgattctaaatttggcgtca
actcgcgcagtgtttccagaaaataaccctcaggtggtgagccacctgacggcgcttggc
gtcatctgcatcgacgatgtgaatcaactacaactgcacgagtga

DBGET integrated database retrieval system