KEGG   Vibrio vulnificus MO6-24/O: VVMO6_01752Help
Entry
VVMO6_01752       CDS       T01415                                 

Definition
phospholipase A1 (EC:3.1.1.32 3.1.1.4)
Orthology
K01058  
phospholipase A1 [EC:3.1.1.32 3.1.1.4]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Glycerophospholipid metabolism
Ether lipid metabolism
alpha-Linolenic acid metabolism
Metabolic pathways
Class
Metabolism; Lipid metabolism; Glycerophospholipid metabolism [PATH:vvm00564]
Metabolism; Lipid metabolism; Ether lipid metabolism [PATH:vvm00565]
Metabolism; Lipid metabolism; Arachidonic acid metabolism
Metabolism; Lipid metabolism; Linoleic acid metabolism
Metabolism; Lipid metabolism; alpha-Linolenic acid metabolism [PATH:vvm00592]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(1871322..1872089)
Genome map
AA seq 255 aa AA seqDB search
MKFKALALLLTAPLFAQAKSLNTISSYEDNYALGTYTSDINDEAYEASGSGMDNLQHFEV
KFQLSVSVPLYRFNKATAVVGSYTQKSLWQLANSDISSPFRETNYKPQLFIAHQSNMLIF
NHLEAGYKHESNGRSSALSRSWDRLYLAAERLDGPLEYGVHLWSVVGDTSENRDIEDYYA
PYEIWMKLYSAAGIFNARGFYNWDDSRGGVEVGYTFYFNDLIGIYIQAYHGYGETLIDYD
HNQTRIGAGFKLVRW
NT seq 768 nt NT seq  +upstreamnt  +downstreamnt
atgaagtttaaagcgctcgcattgctcttaaccgcccctttgtttgctcaggcgaaaagc
ctcaataccatttccagttatgaagataactatgcgcttggcacttatacctccgatatc
aatgatgaagcctatgaagccagtggttccggcatggataatttgcagcacttcgaagtg
aagtttcagctctcggtttcggttcccctctatcgatttaataaagccactgccgtcgtg
ggttcctatacgcaaaaatccctttggcaattggccaattctgatatctcttctcccttt
agagaaaccaactataagccccagctgtttattgctcatcaaagcaatatgctgatcttt
aaccatttggaggcgggctataagcacgagtctaatggtcgttcatcggcgttatctcgt
agttgggatcgtctctaccttgctgcagagcgtttggatgggccgttggagtacggtgtg
cacctttggtctgtggtgggggatacatcagaaaaccgagatattgaagattactacgca
ccgtatgaaatttggatgaagctttacagcgcggcaggcatatttaatgcgcgaggtttc
tacaattgggatgacagccgtggtggcgtagaggtaggctataccttttactttaatgat
ctgattggcatctatattcaggcgtaccatggttatggtgaaactctgattgattatgac
cacaatcaaactcggatcggtgccggtttcaagctggtacgctggtaa

DBGET integrated database retrieval system