KEGG   Vibrio vulnificus MO6-24/O: VVMO6_01752Help
Entry
VVMO6_01752       CDS       T01415                                 

Definition
phospholipase A1 (EC:3.1.1.32 3.1.1.4)
Orthology
K01058  
phospholipase A1 [EC:3.1.1.32 3.1.1.4]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Glycerophospholipid metabolism
Ether lipid metabolism
alpha-Linolenic acid metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Lipid metabolism
   00564 Glycerophospholipid metabolism
    VVMO6_01752
   00565 Ether lipid metabolism
    VVMO6_01752
   00590 Arachidonic acid metabolism
    VVMO6_01752
   00591 Linoleic acid metabolism
    VVMO6_01752
   00592 alpha-Linolenic acid metabolism
    VVMO6_01752
Enzymes [BR:vvm01000]
 3. Hydrolases
  3.1  Acting on ester bonds
   3.1.1  Carboxylic-ester hydrolases
    3.1.1.4  phospholipase A2
     VVMO6_01752
    3.1.1.32  phospholipase A1
     VVMO6_01752
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(1871322..1872089)
Genome map
AA seq 255 aa AA seqDB search
MKFKALALLLTAPLFAQAKSLNTISSYEDNYALGTYTSDINDEAYEASGSGMDNLQHFEV
KFQLSVSVPLYRFNKATAVVGSYTQKSLWQLANSDISSPFRETNYKPQLFIAHQSNMLIF
NHLEAGYKHESNGRSSALSRSWDRLYLAAERLDGPLEYGVHLWSVVGDTSENRDIEDYYA
PYEIWMKLYSAAGIFNARGFYNWDDSRGGVEVGYTFYFNDLIGIYIQAYHGYGETLIDYD
HNQTRIGAGFKLVRW
NT seq 768 nt NT seq  +upstreamnt  +downstreamnt
atgaagtttaaagcgctcgcattgctcttaaccgcccctttgtttgctcaggcgaaaagc
ctcaataccatttccagttatgaagataactatgcgcttggcacttatacctccgatatc
aatgatgaagcctatgaagccagtggttccggcatggataatttgcagcacttcgaagtg
aagtttcagctctcggtttcggttcccctctatcgatttaataaagccactgccgtcgtg
ggttcctatacgcaaaaatccctttggcaattggccaattctgatatctcttctcccttt
agagaaaccaactataagccccagctgtttattgctcatcaaagcaatatgctgatcttt
aaccatttggaggcgggctataagcacgagtctaatggtcgttcatcggcgttatctcgt
agttgggatcgtctctaccttgctgcagagcgtttggatgggccgttggagtacggtgtg
cacctttggtctgtggtgggggatacatcagaaaaccgagatattgaagattactacgca
ccgtatgaaatttggatgaagctttacagcgcggcaggcatatttaatgcgcgaggtttc
tacaattgggatgacagccgtggtggcgtagaggtaggctataccttttactttaatgat
ctgattggcatctatattcaggcgtaccatggttatggtgaaactctgattgattatgac
cacaatcaaactcggatcggtgccggtttcaagctggtacgctggtaa

DBGET integrated database retrieval system