KEGG   Vibrio vulnificus MO6-24/O: VVMO6_01835Help
Entry
VVMO6_01835       CDS       T01415                                 

Definition
alpha-16-galactosidase
Orthology
K07407  
alpha-galactosidase [EC:3.2.1.22]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Galactose metabolism
Glycerolipid metabolism
Sphingolipid metabolism
Class
Metabolism; Carbohydrate metabolism; Galactose metabolism [PATH:vvm00052]
Metabolism; Lipid metabolism; Glycerolipid metabolism [PATH:vvm00561]
Metabolism; Lipid metabolism; Sphingolipid metabolism [PATH:vvm00600]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(1970251..1971990)
Genome map
AA seq 579 aa AA seqDB search
MKSPYTLGNHIPFEVNDDELEVTINNNEVHFCYHGMHNRIIDDRFELFRIPFNFEAQAQL
LGDGFQMLAQTTGTREQVIDIGRCPDNNPQYRLYSQHAPKRYYNYLVIEESQGYTLFGFT
SCRRFAGYFELEQTGNHWHVVAYLDGEQTEIQDWETNTLESVVLLEGESLSELYAEFAQH
IAVHHPIRAGVKQNSPVGWCSWYAYYADVSQQNILANVEQMQGSLEALEWVLLDDGYQAF
MGDWLAPSDKFSGGVKQLIAQIRASGKKPAIWLAPFIAQPESEIFRKHPEWFVKHQDGSL
LKAEDITYGGWRCTPWYILDTSHPEVQEHLTHVVKTMREEWGVELFKLDANYWGTLKGQR
YQKGITGVEAYRLGMDAIAQGAGEAWLLGCNAPMWPSLGLVDAMRVSDDVERHAHRFEQI
AKETFYRSWQHRKLWQIDPDCATFTSLPNQGAQRQEYEFHRNVLLACGGLLLSGDPLTEI
TPFAKSCLAKLMVRQKHNQNAAKFTAFSLNHAFLKLTEKNDLHCLFNYDGQQDKEFTLIS
DTPVHWYDYWTQERLSDEPCQLFVTQLNPGLNAKAIVTA
NT seq 1740 nt NT seq  +upstreamnt  +downstreamnt
atgaaaagcccttataccttaggcaatcacatccctttcgaggtgaatgatgatgaactg
gaagtgacgataaataacaatgaagttcacttctgctatcacggtatgcacaaccgcatc
atcgatgatcgatttgaactttttcgtattcctttcaattttgaagctcaggctcagctc
ttgggggacgggtttcaaatgttggcgcagaccacaggcactcgagagcaagtgatcgac
atcggtcgttgtcctgacaataacccacaatatcgcctttattcacagcatgcgcctaag
cgttactacaattacttagtgattgaggaatcacagggttacaccttgtttggttttacc
tcatgtaggcgcttcgctggctattttgagctggaacagacgggcaaccactggcatgtt
gtcgcttatcttgatggtgaacagacggaaatccaagattgggaaactaatacgctggaa
tctgtggtgctgttggaaggagagtctttgtctgagctctatgctgagtttgcgcaacat
attgcggttcatcatccgatcagagcaggagtgaagcagaattcgccagtaggttggtgt
tcttggtatgcctattatgccgatgtgagccagcaaaatatcttagcgaatgtcgagcag
atgcagggcagcttagaggcgctggagtgggtcttacttgatgatggctatcaggccttt
atgggcgattggcttgctccttctgacaagttttcagggggagtcaaacaactgattgca
caaattcgagcgagtggcaaaaaaccagcgatttggctggcgccctttattgctcagcct
gaatcagagatctttcgtaagcatcccgaatggtttgttaaacatcaggatggctcgctg
ctaaaagcagaggacatcacttatggcggttggcgctgtacaccttggtatatccttgac
acatcacatcctgaagtgcaggagcacctaactcatgtagtaaaaaccatgcgagaagag
tggggtgtagagctctttaaattggatgctaactattgggggacgctaaaagggcagcgt
taccaaaaaggcataacaggtgttgaagcgtatcgactcgggatggatgcgatcgctcaa
ggagcgggcgaagcgtggctacttggttgtaacgcgccaatgtggccttctttaggattg
gttgatgccatgcgcgtttcggatgacgttgagcgccacgcacatcgcttcgaacaaatt
gccaaagagaccttctaccgcagttggcagcatcgaaaactgtggcagattgatcctgac
tgcgcaacgttcacttcgctacctaaccaaggtgcgcaaaggcaagaatatgaatttcac
cgcaatgtcctacttgcgtgtggcgggctgctgctgtcgggcgatccacttactgagatc
acgccattcgccaaatcttgtcttgccaaattgatggttcgtcaaaagcacaatcagaat
gcggcgaaatttaccgcgttcagtctcaaccacgccttcttgaagctaaccgagaaaaac
gatctgcactgtttgttcaattatgacggccagcaagacaaagagtttacgttgatctct
gatacgccagtgcattggtacgactactggacacaagaacgcttaagtgatgagccttgc
cagttgtttgtgacccaattaaatccaggcttgaacgccaaagccatcgtcacagcgtaa

DBGET integrated database retrieval system