KEGG   Vibrio vulnificus MO6-24/O: VVMO6_01835Help
Entry
VVMO6_01835       CDS       T01415                                 

Definition
alpha-16-galactosidase
Orthology
K07407  
alpha-galactosidase [EC:3.2.1.22]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Galactose metabolism
Glycerolipid metabolism
Sphingolipid metabolism
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Carbohydrate metabolism
   00052 Galactose metabolism
    VVMO6_01835
  Lipid metabolism
   00561 Glycerolipid metabolism
    VVMO6_01835
   00600 Sphingolipid metabolism
    VVMO6_01835
Enzymes [BR:vvm01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.22  alpha-galactosidase
     VVMO6_01835
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(1970251..1971990)
Genome map
AA seq 579 aa AA seqDB search
MKSPYTLGNHIPFEVNDDELEVTINNNEVHFCYHGMHNRIIDDRFELFRIPFNFEAQAQL
LGDGFQMLAQTTGTREQVIDIGRCPDNNPQYRLYSQHAPKRYYNYLVIEESQGYTLFGFT
SCRRFAGYFELEQTGNHWHVVAYLDGEQTEIQDWETNTLESVVLLEGESLSELYAEFAQH
IAVHHPIRAGVKQNSPVGWCSWYAYYADVSQQNILANVEQMQGSLEALEWVLLDDGYQAF
MGDWLAPSDKFSGGVKQLIAQIRASGKKPAIWLAPFIAQPESEIFRKHPEWFVKHQDGSL
LKAEDITYGGWRCTPWYILDTSHPEVQEHLTHVVKTMREEWGVELFKLDANYWGTLKGQR
YQKGITGVEAYRLGMDAIAQGAGEAWLLGCNAPMWPSLGLVDAMRVSDDVERHAHRFEQI
AKETFYRSWQHRKLWQIDPDCATFTSLPNQGAQRQEYEFHRNVLLACGGLLLSGDPLTEI
TPFAKSCLAKLMVRQKHNQNAAKFTAFSLNHAFLKLTEKNDLHCLFNYDGQQDKEFTLIS
DTPVHWYDYWTQERLSDEPCQLFVTQLNPGLNAKAIVTA
NT seq 1740 nt NT seq  +upstreamnt  +downstreamnt
atgaaaagcccttataccttaggcaatcacatccctttcgaggtgaatgatgatgaactg
gaagtgacgataaataacaatgaagttcacttctgctatcacggtatgcacaaccgcatc
atcgatgatcgatttgaactttttcgtattcctttcaattttgaagctcaggctcagctc
ttgggggacgggtttcaaatgttggcgcagaccacaggcactcgagagcaagtgatcgac
atcggtcgttgtcctgacaataacccacaatatcgcctttattcacagcatgcgcctaag
cgttactacaattacttagtgattgaggaatcacagggttacaccttgtttggttttacc
tcatgtaggcgcttcgctggctattttgagctggaacagacgggcaaccactggcatgtt
gtcgcttatcttgatggtgaacagacggaaatccaagattgggaaactaatacgctggaa
tctgtggtgctgttggaaggagagtctttgtctgagctctatgctgagtttgcgcaacat
attgcggttcatcatccgatcagagcaggagtgaagcagaattcgccagtaggttggtgt
tcttggtatgcctattatgccgatgtgagccagcaaaatatcttagcgaatgtcgagcag
atgcagggcagcttagaggcgctggagtgggtcttacttgatgatggctatcaggccttt
atgggcgattggcttgctccttctgacaagttttcagggggagtcaaacaactgattgca
caaattcgagcgagtggcaaaaaaccagcgatttggctggcgccctttattgctcagcct
gaatcagagatctttcgtaagcatcccgaatggtttgttaaacatcaggatggctcgctg
ctaaaagcagaggacatcacttatggcggttggcgctgtacaccttggtatatccttgac
acatcacatcctgaagtgcaggagcacctaactcatgtagtaaaaaccatgcgagaagag
tggggtgtagagctctttaaattggatgctaactattgggggacgctaaaagggcagcgt
taccaaaaaggcataacaggtgttgaagcgtatcgactcgggatggatgcgatcgctcaa
ggagcgggcgaagcgtggctacttggttgtaacgcgccaatgtggccttctttaggattg
gttgatgccatgcgcgtttcggatgacgttgagcgccacgcacatcgcttcgaacaaatt
gccaaagagaccttctaccgcagttggcagcatcgaaaactgtggcagattgatcctgac
tgcgcaacgttcacttcgctacctaaccaaggtgcgcaaaggcaagaatatgaatttcac
cgcaatgtcctacttgcgtgtggcgggctgctgctgtcgggcgatccacttactgagatc
acgccattcgccaaatcttgtcttgccaaattgatggttcgtcaaaagcacaatcagaat
gcggcgaaatttaccgcgttcagtctcaaccacgccttcttgaagctaaccgagaaaaac
gatctgcactgtttgttcaattatgacggccagcaagacaaagagtttacgttgatctct
gatacgccagtgcattggtacgactactggacacaagaacgcttaagtgatgagccttgc
cagttgtttgtgacccaattaaatccaggcttgaacgccaaagccatcgtcacagcgtaa

DBGET integrated database retrieval system