KEGG   Vibrio vulnificus MO6-24/O: VVMO6_02282Help
Entry
VVMO6_02282       CDS       T01415                                 

Definition
beta-hexosaminidase (EC:3.2.1.52)
Orthology
K12373  
hexosaminidase [EC:3.2.1.52]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Other glycan degradation
Amino sugar and nucleotide sugar metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Class
Metabolism; Carbohydrate metabolism; Amino sugar and nucleotide sugar metabolism [PATH:vvm00520]
Metabolism; Glycan biosynthesis and metabolism; Other glycan degradation [PATH:vvm00511]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(2452736..2455387)
Genome map
AA seq 883 aa AA seqDB search
MLKQTLIAASVIASLAGCSTLQSDEQRVVNSLADNLDIQYQVMTNHGANEGLACGDMGAE
WASCNRVNMTLVNQGDAVNAKDWAIYFHSIRLILDVENDQFKISRVTGDLHKLEPTDKFD
GFAAGEEVVLPLIGEYWTLFETDFMPGAFVTAPNAEPKMIASLNTEDVASFVAGLEGNNL
KRTPDDNNVFASAVSRFEKNEDLAKQDVSTTLLPTPLFVEAGKGTIDIAAGIALPKDAFD
AAQFAAIQERAEVVGVNVRGDVPVSITVVPADFTGELAKSGAYEMSIQGDGIAIKAFDQA
GAFYAVQSIFGLIDSQHANSLPQLSIKDAPRFDYRGVMVDVARNFHSKDAILATLDQMAA
YKMNKLHLHLTDDEGWRLEIPGLPELTEVGANRCFDVEEKSCLLPQLGSGPTSDNFGSGY
FSKADYVEILKYAKARNIEVIPEIDMPAHARAAVVSMEARYDRLMAEGKEAQANEFRLMD
PQDTSNVTTVQFYDKQSFINPCMESSTRFVDKVISEVAAMHAEAGAPLTTWHFGGDEAKN
IKLGAGFQDVNAQDKVSWKGTIDLSKQDKPFAQSPQCQTLITDGTVSDFGHLPSHFAEQV
SKIVAEKGIPNFQAWQDGLKYSEGENAFATENTRVNFWDVLYWGGTSSVYEWSKKGYDVI
VSNPDYVYMDMPYEVDPKERGYYWATRATDTRKMFGFAPENMPQNAETSLDRDGNGFTGK
GEVEAKPFYGLSAQLWSETVRNDEQYEYMVFPRVLAAAERAWHRADWENDYKVGVEYSQN
SNLVDKAALNQDYNRFANVLGQRELAKLEKSGIDYRLPVPGAKVEEGKLAMNVQFPGVTL
QYSLDGKNWLTYADDARPTVEGEVFIRSVSATGEKASRVTSVK
NT seq 2652 nt NT seq  +upstreamnt  +downstreamnt
atgttgaaacaaactttaattgctgcgtcggttatcgcttctttagcgggttgctctaca
ttacaaagtgatgagcaacgtgtcgtcaattcattagcggataatttggatattcaatac
caagttatgacaaatcacggtgcgaacgaggggctagcctgtggtgatatgggggccgag
tgggcttcttgtaaccgagtgaatatgacgctggtgaatcaaggtgatgccgtcaatgcc
aaagattgggccatttactttcacagcatccgtctgattttagatgtggaaaatgaccaa
tttaaaatctctcgtgtaacaggtgacctacacaaattagaaccgacggataaatttgat
ggttttgccgcaggtgaagaagtcgtactgcctctgattggtgaatactggacgttgttt
gaaaccgatttcatgccaggtgctttcgtcactgcgccaaacgcagagccaaagatgatt
gcctctctaaacacggaagatgtggcatctttcgtggctggtcttgaaggtaacaaccta
aaacgtacgccagatgacaacaacgtctttgcgagtgctgtgtctcgcttcgagaagaac
gaagacctagcaaaacaagatgtatcaactacgctgctaccgacgccactgtttgtggaa
gcaggcaagggcactattgatatcgcggcgggtattgcgctgcctaaagacgcattcgat
gcagctcaatttgcagcaattcaagaacgtgcagaagtggttggtgtgaatgttcgcggt
gatgttccggttagcatcacggttgttccagcggacttcactggtgagttagcaaaatcg
ggtgcttacgagatgagcatccaaggcgacggtattgcgattaaagcgtttgaccaagca
ggcgctttctacgcagtgcaatctatctttggcctgatagacagccaacatgctaattct
ctaccacaactgtcgatcaaagatgcgcctcgttttgattaccgtggcgtaatggtggat
gtggctcgtaacttccactctaaagacgccattcttgcgacgctagaccaaatggcggcg
tataagatgaacaaacttcatcttcatctaacggatgatgaaggttggcgtttggaaatc
cctggtctgcctgagttgacagaagtgggtgctaatcgttgtttcgacgttgaagagaaa
agctgtttactgcctcagcttggctcgggtccaacgtcagacaactttggttctggctac
ttcagcaaagcagactacgtggaaatcctgaagtacgcgaaagcacgtaacatcgaagtg
attccagaaatcgacatgccagcccacgctcgtgccgcagttgtatcgatggaggcacgt
tacgatcgtcttatggccgaaggaaaagaagcacaagcgaacgaattccgcctgatggat
cctcaagatacatcgaacgtgacgacggttcagttctacgataagcaaagctttatcaac
ccatgtatggaatcgtcaacgcgctttgttgataaagtgatttcagaagtggcagcaatg
cacgcagaagcaggcgcaccgctaacaacatggcacttcggtggtgacgaagcgaagaac
atcaagctaggcgcgggtttccaagatgttaacgcgcaagacaaagtaagctggaaaggc
acgattgacctgtctaagcaagacaagccatttgcccagtcgccacaatgtcagacgctc
attaccgatggcacagtcagtgacttcggtcatctgcctagccactttgcagagcaagtg
tcgaagattgtggccgagaagggcattccaaacttccaagcgtggcaagatggcttgaag
tacagcgaaggtgagaacgcgttcgcaacagaaaatactcgcgtaaacttctgggacgtt
ctgtactggggcggtacatcttcagtgtacgagtggtctaagaaaggttacgacgtgatc
gtgtctaacccagactacgtttacatggacatgccatacgaagtggacccgaaagagcgt
ggttactactgggcaacacgtgcaacggatacgcgtaagatgtttggctttgcgccagag
aacatgccgcaaaacgctgaaacctctctagaccgtgatggcaatggctttacgggcaaa
ggtgaagtcgaagcgaaacctttctacggcctatcagcacagctttggtctgagacagta
cgtaacgacgagcaatacgagtacatggtattccctcgcgtactcgccgccgctgagcgt
gcatggcaccgcgcggattgggaaaacgactacaaagtgggcgttgaatactcgcaaaac
tctaacctagtagacaaagcagcactaaaccaagactacaaccgctttgccaacgtactt
ggtcaacgtgaactggcgaaactggaaaaatcaggcatcgactaccgcctacctgtaccg
ggtgcgaaagtcgaagagggtaagctagctatgaacgttcagttccctggcgtcacgctt
caatactcgctagacggcaaaaactggctgacgtacgcggatgatgctcgtccaaccgta
gaaggtgaagtctttatccgttctgtgtctgcgacaggcgagaaagcaagccgagtaaca
agcgtgaagtaa

DBGET integrated database retrieval system