KEGG   Vibrio vulnificus MO6-24/O: VVMO6_02452Help
Entry
VVMO6_02452       CDS       T01415                                 

Definition
(GenBank) isocitrate lyase
  KO
K01637  isocitrate lyase [EC:4.1.3.1]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
vvm00630  Glyoxylate and dicarboxylate metabolism
vvm01100  Metabolic pathways
vvm01110  Biosynthesis of secondary metabolites
vvm01120  Microbial metabolism in diverse environments
vvm01200  Carbon metabolism
Module
vvm_M00012  Glyoxylate cycle
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Carbohydrate metabolism
   00630 Glyoxylate and dicarboxylate metabolism
    VVMO6_02452
Enzymes [BR:vvm01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.3  Oxo-acid-lyases
    4.1.3.1  isocitrate lyase
     VVMO6_02452
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADV87474
Position
I:complement(2633178..2634491)
Genome map
AA seq 437 aa AA seqDB search
MTNLTRRQQIEALEKDWATNPRWKNVKRTYTAEEVVALRGSMVPANTIAQRGADKLWSLV
NGSSKKGYVNCLGALTGGQAVQQAKAGIEAIYLSGWQVAADNNTASTMYPDQSLYPVDSV
PSVVKRINNSFRRADQIQWSNGKSPEEGGIDYFLPIVADAEAGFGGVLNAYELMKSMIEA
GAAGVHFEDQLASVKKCGHMGGKVLVPTQEAVQKLVAARLAADVAGTTTLVIARTDANAA
DLLTSDCDPYDADFIVGERTQEGFYRVRAGIDQAISRGLAYAPYADLIWCETATPCLEEA
RKFAEAIHAEYPDQLLAYNCSPSFNWEKNLDAETIAKFQQELADMGYKYQFITLAGIHNM
WFNMFELAHAYAQGEGMRHYVEKVQRPEFEAAEKGYTFVAHQQEVGTGYFDKMTNTIQGG
NSSVTALTGSTEEDQFH
NT seq 1314 nt NT seq  +upstreamnt  +downstreamnt
atgacaaacttaactcgccgccagcaaatcgaagctctggaaaaagattgggcaaccaat
cctcgttggaaaaacgtcaaacgcacttacacagctgaggaagtggtggccttacgtggc
tctatggtgccagctaataccatcgcgcagcgtggcgccgacaagttgtggtcgttggtg
aatggtagctcgaaaaaaggctatgtgaattgtctaggcgcactaaccggtggccaagcg
gtgcagcaagccaaagcggggatagaagcgatctacctatcgggttggcaggttgcagcg
gataacaacaccgcctcgaccatgtacccagaccaatcactttaccctgtggattcggtt
ccttcagtagtcaaacgcattaacaattcgttccgccgcgcagaccaaattcaatggtcg
aatggtaagtcgccagaagagggtggaattgattacttcttgcctatcgttgctgatgcg
gaagcgggctttggtggtgtgctgaatgcgtatgagctgatgaagtcgatgattgaagcg
ggggccgcgggtgtacactttgaagaccaattggcttcggtgaagaagtgtggccatatg
ggcggtaaagtattggttccaacgcaagaagcggtgcaaaaactggttgctgcgcgtcta
gccgcagatgttgctggtacaacgacattggtgattgctcgaaccgatgccaatgcggcg
gacttgttgacgtcagattgtgacccatatgacgcagactttattgttggcgagcgcact
caggaaggtttctatcgtgttcgtgcagggattgaccaagcgatctcacgtggccttgct
tatgcgccatatgcggatcttatttggtgtgaaacggcaactccgtgtcttgaagaagca
cgtaagtttgctgaggctattcatgcggaatacccagaccaacttttggcatacaactgc
tcgccatcatttaactgggagaagaacttggatgcagagaccattgctaagttccaacaa
gaactcgcagatatgggctataagtaccagttcatcaccctagctggtattcacaacatg
tggttcaacatgtttgaactggcacacgcatatgctcaaggtgaaggtatgcgtcactac
gttgagaaagttcagcgtcctgaatttgaagcggcggaaaaaggctacaccttcgttgca
caccaacaagaagtgggtacgggttactttgataagatgaccaacaccatccaaggtggt
aactcttcagtcacggcactgacgggctctaccgaagaagaccagttccattaa

DBGET integrated database retrieval system