KEGG   Vibrio vulnificus MO6-24/O: VVMO6_02492Help
Entry
VVMO6_02492       CDS       T01415                                 

Definition
beta N-acetyl-glucosaminidase (EC:3.2.1.52)
Orthology
K01207  
beta-N-acetylhexosaminidase [EC:3.2.1.52]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
beta-Lactam resistance
Amino sugar and nucleotide sugar metabolism
Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Carbohydrate metabolism
   00520 Amino sugar and nucleotide sugar metabolism
    VVMO6_02492
 Human Diseases
  Drug resistance
   00312 beta-Lactam resistance
    VVMO6_02492
Enzymes [BR:vvm01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.52  beta-N-acetylhexosaminidase
     VVMO6_02492
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(2682117..2683103)
Genome map
AA seq 328 aa AA seqDB search
MGPLWVDVAGYELNAEDKEILQHPSVGGLILFTRNYHDSEQLLALTAAIRQVVKRPFLIG
VDQEGGRVQRFRDGFSLIPAAAEYAKQANGQAMAQMGGWLMAAELIAHDIDLSFAPVLDQ
GFGCKAIGNRAFGEDTQTILRHSSAYMQGMKAVGMATTGKHFPGHGGVVADSHLETPFDQ
RSDIVEQDMAIFKTQIDAGLLDAMMPAHVIYPHYDPQPASGSEYWLKQVLRQQLGFKGLI
FSDDLTMEGAAVMGGPADRALQALNAGCDMLLMCNKRDAQVAALDALPIVEVPLALSLLK
KRSFSLSELKLAPQWKEARENMLRILGH
NT seq 987 nt NT seq  +upstreamnt  +downstreamnt
atggggccactttgggttgatgtcgcaggttatgaactgaatgcagaagacaaagaaatt
ttacagcatccatccgttggcggattgatcttatttacccgcaactatcacgatagtgaa
cagctgttggcgctcactgcggccattcgccaagtggtcaagcgtccttttctgattggc
gtcgaccaagagggagggcgagttcagcgtttccgtgatggtttttctctgattcccgcc
gcggcagaatatgccaaacaagccaatgggcaagcgatggcacaaatgggcggttggctg
atggcggccgaactgattgctcatgatatcgacctgagttttgcccccgtgttagaccaa
ggctttggatgtaaagcgattggcaatcgagcgtttggtgaagatacgcagaccatcttg
cgccatagcagtgcctacatgcagggcatgaaagcggtggggatggcaacaacgggcaaa
cacttccctggtcatggcggcgtggtggcagattcgcatcttgaaaccccgtttgaccaa
cgaagcgatatcgttgagcaggatatggcaatcttcaaaacgcaaatagacgcaggctta
ttagacgccatgatgcctgcgcatgtgatttacccgcattacgatcctcaaccagcgagt
ggttcagaatattggttaaaacaggtattacgccagcaattgggtttcaagggcttaatt
ttttctgatgatctcaccatggaaggggccgccgtgatgggaggccctgcagatagggct
ttacaagcattgaatgcgggctgtgacatgcttctgatgtgcaataagcgcgatgcacaa
gtggcagccttggacgcactgcctatcgtcgaggttcccttggcattatccttgttgaag
aaacgtagcttcagcctttctgaactgaaattggcgccgcaatggaaggaagcaagagaa
aacatgctacgcatactgggccactaa

DBGET integrated database retrieval system