KEGG   Vibrio vulnificus MO6-24/O: VVMO6_02621Help
Entry
VVMO6_02621       CDS       T01415                                 

Definition
2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase (EC:2.7.6.3)
Orthology
K00950  
2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase [EC:2.7.6.3]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Folate biosynthesis
Metabolic pathways
Module
Tetrahydrofolate biosynthesis, GTP => THF
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Metabolism of cofactors and vitamins
   00790 Folate biosynthesis
    VVMO6_02621
Enzymes [BR:vvm01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.6  Diphosphotransferases
    2.7.6.3  2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
     VVMO6_02621
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(2829270..2829752)
Genome map
AA seq 160 aa AA seqDB search
MNTVYIGVGSNIEREKHARAAWQELTLLGEALQASPIYECAAVGFDSHAFFNFVIRLNTS
MTLEELASQLRQIELRWGREENAAKYQDRTLDLDIVLFGECISSQKPELPRSDIFKYPFV
IQPLYDLQPDLVIPGDGRTVEEIWQTARDLDTLKAVDFSL
NT seq 483 nt NT seq  +upstreamnt  +downstreamnt
atgaacaccgtctatatcggcgtaggcagtaatattgagcgagaaaagcacgcacgagcc
gcttggcaagagctcactttgcttggcgaagccttacaagcctcaccgatatatgaatgt
gccgctgttggtttcgacagccatgcctttttcaattttgtcattcgtctcaatacgtct
atgacgttagaggaattggcttctcagctccgccaaatcgaactgcgatggggccgagaa
gaaaatgcagcgaagtatcaggatcgaacactggatcttgatattgtgctgttcggcgaa
tgcatttcgagccaaaagcctgaactgcctcgcagtgatatctttaaatatccctttgtc
atacaaccgctttatgatttgcagccggatctggtgattccaggagatggccgtaccgtg
gaagagatttggcaaactgcacgcgatctcgacacattgaaagcggttgatttttcatta
taa

DBGET integrated database retrieval system