KEGG   Vibrio vulnificus MO6-24/O: VVMO6_02675Help
Entry
VVMO6_02675       CDS       T01415                                 

Definition
UDP-N-acetylglucosamine 1-carboxyvinyltransferase (EC:2.5.1.7)
Orthology
K00790  
UDP-N-acetylglucosamine 1-carboxyvinyltransferase [EC:2.5.1.7]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Amino sugar and nucleotide sugar metabolism
Peptidoglycan biosynthesis
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Carbohydrate metabolism
   00520 Amino sugar and nucleotide sugar metabolism
    VVMO6_02675
  Glycan biosynthesis and metabolism
   00550 Peptidoglycan biosynthesis
    VVMO6_02675
Enzymes [BR:vvm01000]
 2. Transferases
  2.5  Transferring alkyl or aryl groups, other than methyl groups
   2.5.1  Transferring alkyl or aryl groups, other than methyl groups (only sub-subclass identified to date)
    2.5.1.7  UDP-N-acetylglucosamine 1-carboxyvinyltransferase
     VVMO6_02675
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(2889590..2890855)
Genome map
AA seq 421 aa AA seqDB search
MEKFRVIGSTQPLLGEVTISGAKNAALPILFASILAEEPVEVANVPHLRDIDTTMELLKR
LGAKVERNGSVHVDPSSIDEYCAPYDLVKTMRASIWALGPLVARFGQGQVSLPGGCAIGA
RPVDLHITGLEQLGATITLEDGYVKAHVDGRLQGAHIVMDKVSVGATITIMCAATLAEGT
TVLDNAAREPEIVDTAKFLNTLGAKISGAGTDTITIEGVERLGGGKHAVVADRIETGTFL
VAAAVSGGKVVCHNTQAHLLEAVLAKLEEAGALVETGEDWISVDMTGRELKAVNIRTAPH
PGFPTDMQAQFTLLNMMAKGGGVITETIFENRFMHVPELKRMGAKAEIEGNTVICGDVER
LSAAQVMATDLRASASLVIAGCIAKGETIVDRIYHIDRGYDKIENKLNALGAKIERFRES
N
NT seq 1266 nt NT seq  +upstreamnt  +downstreamnt
atggaaaagttccgtgtaattgggtcgactcagccattgctgggtgaggtgactatttca
ggtgccaaaaacgctgcactgccgattttatttgcgtcgattctggctgaagagccagtt
gaagtggccaatgtgccgcatcttcgagatattgataccaccatggagctgctaaagcgc
cttggtgccaaagtggaacgcaatggttccgttcatgttgaccctagctctatcgatgaa
tattgtgcgccttatgatttggtgaaaaccatgcgtgcatcgatctgggcattagggccg
cttgttgctcgctttggtcaaggacaagtgtctctgccgggtggttgtgcgatcggtgct
cgtcccgtggatttacacatcactggccttgagcaactaggtgccaccatcacattagaa
gatggttacgttaaagcgcatgtcgacggccgtttacaaggcgcacacattgtcatggac
aaagtgagcgtaggtgccacgatcaccatcatgtgtgcagccacacttgccgaaggcacg
acggttttagataacgcagcgcgtgagccagaaattgtcgatactgcgaaattcctcaac
acgcttggggctaaaatcagcggtgcaggcactgacaccatcaccattgagggcgttgaa
cgtctgggtggtggtaagcatgccgtggtggcagaccgcatcgaaacggggactttcctt
gttgctgcagcggtgtctggcggtaaagtcgtttgccacaatacgcaagcgcatttactt
gaagccgtgttggcgaagttggaagaagcgggcgccttggttgaaactggcgaagattgg
atttctgtcgatatgacaggtcgagagctcaaagcggtcaatatccgcacggcgcctcac
ccgggtttcccgaccgatatgcaagcacagtttaccttgctgaatatgatggcgaaaggc
ggtggcgtgatcactgaaaccatctttgaaaaccgtttcatgcatgttccagagctaaaa
cgtatgggtgcaaaagcggagattgaaggtaacactgtcatctgtggtgacgtggagcgt
ttgagcgcagcacaagttatggcgaccgatctacgagcgtcagccagcttagtgattgca
ggttgtatcgctaagggtgaaaccatcgttgatcgcatttaccacattgaccgtggctac
gacaaaatcgagaacaagcttaatgcactgggtgcaaagattgagcgttttcgtgagtca
aactaa

DBGET integrated database retrieval system