KEGG   Vibrio vulnificus MO6-24/O: VVMO6_02860Help
Entry
VVMO6_02860       CDS       T01415                                 

Definition
3'(2'),5'-bisphosphate nucleotidase (EC:3.1.3.7)
Orthology
K01082  
3'(2'), 5'-bisphosphate nucleotidase [EC:3.1.3.7]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Sulfur metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Energy metabolism
   00920 Sulfur metabolism
    VVMO6_02860
Enzymes [BR:vvm01000]
 3. Hydrolases
  3.1  Acting on ester bonds
   3.1.3  Phosphoric-monoester hydrolases
    3.1.3.7  3'(2'),5'-bisphosphate nucleotidase
     VVMO6_02860
Transfer RNA biogenesis [BR:vvm03016]
 Eukaryotic Type
  tRNA degradation factors
   Rapid tRNA decay (RTD) pathway factors
    VVMO6_02860
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:3062415..3063242
Genome map
AA seq 275 aa AA seqDB search
MPTSQDLSALLPQVIDIARTAGQLILDIYQSKQYQEYTKSDETPVTSADLAAHKLITQRL
SELTPDIPVLSEEAADISLEQRAQWNRYWLVDPLDGTQEFIARSGDFATIIALVENNKPV
MGVVYGPVSGVTYYAYQGKGAWKIPEMNESLKIQTHKHELPGQNIAIAISRRQDINRITS
RMSSSWNYDLVPLGSAALKACLVAEGAVDCYLRLGPTGEWDTAATQCIVEEAGGRILSTY
LEPLSYNERDTLENPNFIVLGDADLPWNDILQVKG
NT seq 828 nt NT seq  +upstreamnt  +downstreamnt
atgcctacctcacaggatttatcggcactgttgccgcaagttatcgatattgctcgcacc
gcggggcaattgattctggatatctaccaaagtaagcagtaccaagaatacaccaaaagc
gatgagacgccggtcaccagcgccgatctcgccgcgcataaactgatcacccaacgactg
agtgagttaaccccagacattccagtgctgtctgaagaagcggcggatatcagcttggaa
caacgcgcgcaatggaaccgttactggttggtggaccctcttgatgggacgcaggaattt
atcgcccgcagcggcgattttgccaccatcatcgccttagtggagaacaacaagccggta
atgggcgtggtgtatggtccggtttcaggcgtaacttactatgcgtatcaaggcaaaggc
gcatggaagatccctgagatgaacgaaagcttgaaaattcaaacccacaaacatgaactg
cccggacaaaacatcgcgattgccatcagccgccgtcaggacatcaatcgcatcaccagc
cgtatgagcagcagttggaattacgatttggtgccgttaggctctgcggcgttgaaagcg
tgcttggtcgcggaaggggcggtggattgctatttgcgccttggcccaactggggaatgg
gacaccgcggcgacacaatgtatcgtggaagaggccggtgggcgcatcctcagcacctac
ttggaaccgctttcttataacgaacgagacaccttggaaaatccgaacttcatcgtatta
ggcgatgccgatttgccgtggaacgacattttgcaggtcaaaggctag

DBGET integrated database retrieval system