KEGG   Vibrio vulnificus MO6-24/O: VVMO6_02896Help
Entry
VVMO6_02896       CDS       T01415                                 

Definition
porphobilinogen synthase (EC:4.2.1.24)
Orthology
K01698  
porphobilinogen synthase [EC:4.2.1.24]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Porphyrin and chlorophyll metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Metabolism of cofactors and vitamins
   00860 Porphyrin and chlorophyll metabolism
    VVMO6_02896
Enzymes [BR:vvm01000]
 4. Lyases
  4.2  Carbon-oxygen lyases
   4.2.1  Hydro-lyases
    4.2.1.24  porphobilinogen synthase
     VVMO6_02896
Exosome [BR:vvm04147]
 Exosomal proteins
  Exosomal proteins of other body fluids (saliva and urine)
   VVMO6_02896
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
I:complement(3103632..3104675)
Genome map
AA seq 347 aa AA seqDB search
MSVSIQGPFPARRMRRMRKHEFSRRLMAENQLSVSDLIYPMFILMGKDRRESVESMPGVE
RLSIDLMLEEAQYLAQLGVPAIALFPVVNQDAKSLCAAEAYNPEGLVQRAVRALKEHVPA
MGVITDVALDPFTTHGQDGIIDEEGYVMNDETTEVLIKQALSHAEAGADVVAPSDMMDGR
IGRIRDALEEAGYIHTQIMAYSAKYASNYYGPFRDAVGSASNLKGGNKKNYQMDPANSDE
ALHEVALDINEGADMVMVKPGMPYLDVVRRVKTELQVPTFAYQVSGEYAMHKAAIQNGWL
KERETVLESLLCFKRAGADGILTYFAKDVAQWLAEDNAQAAQFLKTE
NT seq 1044 nt NT seq  +upstreamnt  +downstreamnt
gtgtctgtatctattcaaggcccattcccagcgcgccgtatgcgccgtatgcgcaagcat
gagttcagtcgtcgtttgatggcggagaatcagctatcggttagcgacttgatctacccg
atgtttatcttaatgggtaaagatcgtcgtgagagtgttgaatctatgcctggcgtagag
cgcctttccattgacttgatgcttgaagaagcacagtaccttgctcagcttggtgtgcca
gcgattgctcttttccctgtggtgaatcaagacgcgaaaagcctttgtgccgcggaagct
tataaccctgaaggcttggttcagagagcagtgcgtgcattaaaagagcacgtgccagca
atgggcgtcattacagacgtcgcacttgatccttttaccacccatggtcaagacggcatc
attgatgaagaaggctatgtgatgaatgatgagacaacggaagttctgatcaaacaagcg
ttgtcgcatgcggaagcgggtgcggatgtagtggccccctcagatatgatggatggtcga
attggccgtatccgtgacgctctagaggaagcgggttacattcatactcaaatcatggct
tactccgccaaatacgcatccaactactacgggccattccgtgatgcggtgggctctgca
tccaacctaaaaggtggaaacaaaaagaactaccaaatggatcccgccaacagcgatgaa
gcgttgcacgaagtagcattagacatcaatgaaggtgccgatatggtgatggtgaagccg
ggcatgccatacctcgatgttgtacgccgtgttaaaacagagcttcaagtaccgacattc
gcctatcaagtgtcgggcgaatatgcgatgcacaaagccgcgattcaaaatggttggttg
aaagagcgtgaaacggtgttggaatcgttgctttgctttaaacgagcgggtgcggatggc
attttgacttactttgccaaagatgtcgcacaatggttagcggaagacaatgcgcaagcg
gcgcaattcttgaaaactgaatag

DBGET integrated database retrieval system