KEGG   Vibrio vulnificus MO6-24/O: VVMO6_03057Help
Entry
VVMO6_03057       CDS       T01415                                 

Definition
4-alpha-glucanotransferase (EC:2.4.1.25)
Orthology
K00705  
4-alpha-glucanotransferase [EC:2.4.1.25]
Organism
vvm  Vibrio vulnificus MO6-24/O
Pathway
Starch and sucrose metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:vvm00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    VVMO6_03057
Enzymes [BR:vvm01000]
 2. Transferases
  2.4  Glycosyltransferases
   2.4.1  Hexosyltransferases
    2.4.1.25  4-alpha-glucanotransferase
     VVMO6_03057
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:86408..88588
Genome map
AA seq 726 aa AA seqDB search
MKEQTALKKVAEMARLADSYVSAWGDEALVSEETLRRLLNSLGYDTSSDEKLLASAEKKH
KKDVLAPVLVLRDGDPVEVELNLGTSARESEFNWRLETEQGEVLEGYLQSQIVRDERAEG
GPLVFALPKDLAWGYHKLYVSRKRRKAPYEMALIITPRACFKQDSLELNKKLWGPSIQLY
TLRTQHNWGIGDFGDLKLLVSDIASRGGDFIGLNPIHSLFPANPEGASPYSPSSRRWLNI
LYIDVSSVPEFALSAEAQQKVGSAEFQQRLQKARESHWVNYTEVAELKMSVLPLLFAEFK
TRHLDKNSDRARAFLEFVEEGGDSLVHQAAFDALHAELHAQDSNVWGWPVFPEQYRRFDS
AATQKFIKDNQEKVHLYMYLQWIADGQIKEAQALAEEKGMSVGLYRDLAVGVADSGSETW
ADNGNLVLDASIGAPPDILGPLGQNWGLPPLNPEVLQATGYDAYIKLLRANMKHCGALRI
DHVLGLLRLWWIPKGEKATEGAYLYYPVEDMLAILALESHRHQCSVIGEDLGTVPDEIVD
ILRDAGVHSYKVFFFETSKEDGGFISPKHYADQSMAALCTHDMPTLRGFWHCDDLKMGRE
IGLYPNEEQLNGLFDDRLKCKQGILDSVRWHGYLPEGIGHDAQYVPMDAHLSEALQLHVA
AGASALLSVQLEDWLQMDNPVNIPGTVDEYPNWRRKLSMNLEEIFSREDVNRIARRLTEV
RAQASK
NT seq 2181 nt NT seq  +upstreamnt  +downstreamnt
atgaaagaacaaacagcattaaagaaagtcgcagaaatggcacgattagctgacagctat
gtcagcgcttggggagacgaagcattggtctccgaagaaacgctacgccgcctgctcaac
tctcttggctatgacactagcagcgatgaaaaactactggcttcagctgagaaaaaacac
aagaaagacgtattagcgccagtattggtattgcgtgatggcgatccggtggaagtggaa
ctgaatcttggcaccagtgcgcgtgaaagcgagttcaactggcgtttagaaacagaacaa
ggagaggtactggaaggctatcttcagtcacagattgttcgcgatgaacgtgccgagggt
ggccctctagtgtttgccctgccaaaagatttggcttggggttatcacaaactatacgtg
agccgtaagcgtcgtaaagcaccgtatgaaatggcgttaatcatcacgccacgcgcttgt
ttcaaacaagattctctagagttgaacaaaaaactctggggcccaagtattcagctttac
accctacgcacccagcacaactggggtatcggtgattttggcgatcttaaattgctggtg
agtgacatcgcatctcgcggtggtgatttcatcggtctgaacccgatccactcgctattt
cctgccaacccagaaggcgctagcccatacagcccatcgtctcgccgttggttgaacatt
ctttatatcgatgtgagctctgttcctgagtttgcgctcagtgcggaagcgcaacagaaa
gttggcagcgccgaattccagcagcgcctgcaaaaagcgcgtgaatcacattgggtgaac
tacaccgaagtggcagagctgaaaatgagcgtattgccactgctgtttgcggagttcaaa
actcgtcatctcgacaaaaacagcgatcgtgctcgcgcattcctagagtttgtggaagaa
ggcggtgacagcctcgtgcaccaagcggcgttcgatgcattgcacgcagagctacacgcg
caagattcaaacgtgtggggctggccagttttccctgagcaataccgccgctttgattct
gccgcgacgcagaaattcatcaaagacaaccaagaaaaagtgcacctttacatgtacttg
cagtggattgccgacggccagatcaaagaagcgcaagcgctggctgaagagaaaggcatg
tccgttggtctctaccgtgaccttgcagtcggtgtggctgattctggtagcgaaacatgg
gcagataacggcaacctagtattggatgccagcatcggtgcgccaccggatatccttggt
ccactgggccaaaactggggtctgccaccactcaaccctgaagtgctgcaagccactggt
tatgacgcgtacatcaaactgctgcgtgccaacatgaaacattgtggcgcactgcgtatt
gaccacgtacttggccttcttcgcctatggtggattccaaaaggcgaaaaagcgacggaa
ggggcgtacctctactacccagtcgaagacatgctagcgattttggcgttggaatctcac
cgtcatcagtgcagcgtgatcggcgaagacttgggtacggtgccagatgaaatcgttgat
attctgcgtgatgcgggcgtgcactcgtacaaagtgttcttcttcgaaacatcaaaagaa
gatggcggtttcatttcgccaaaacactatgccgatcagtcgatggcggcattgtgtacc
cacgatatgccaacgcttcgcggcttctggcattgtgatgacctcaaaatggggcgtgaa
attggcctctatccaaacgaagagcagctcaatggcttgttcgacgatcgcctaaaatgc
aagcaaggcattctggacagcgtgcgttggcatggttacttgccagaaggcattggccac
gatgcgcaatacgtgccaatggatgcgcatttaagtgaagcattgcagttgcatgttgca
gcaggcgcttccgcattgctcagtgttcagcttgaagactggttgcaaatggacaaccca
gtcaacatcccgggcacggtcgatgagtacccgaactggcgtcgtaaattgtcgatgaac
cttgaagagattttcagccgtgaggatgtgaatcgaatcgctcgtcgtctaacggaagtg
cgcgcgcaagcgagcaaataa

DBGET integrated database retrieval system