KEGG   Vibrio vulnificus MO6-24/O: VVMO6_03415Help
Entry
VVMO6_03415       CDS       T01415                                 

Definition
diguanylate cyclase
Orthology
K13590  
diguanylate cyclase
Organism
vvm  Vibrio vulnificus MO6-24/O
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
II:complement(514685..515701)
Genome map
AA seq 338 aa AA seqDB search
MTSDDFKKSTANLKKAVPLMIKNHVAATPANYALWYTYVDNTIPQLNQEMDTVLENYGIC
PPATNEQLYNNYVASKAETSMKDLRSNIEVLLLEVASSMTDTIADTSSFSTLVDKNFSKL
EKVEDEGLSIEEVMGVIRELVTESREIRHSTRFLTSQLNNASNEISRLKEQLAEVQRDAL
FDGLSTLYNRRAFDSDLKALVNAQQNLSLILLDIDHFKTFNDNYGHLFGDSVIRAIAKRL
QTSCREGIAAYRFGGEEFALIVPNKSLRIARQYAESLRRTIEKLKVKDKRSGQQVENISA
SFGVAELKPDETAESLIERADKLLYEAKQLGRNRVMPL
NT seq 1017 nt NT seq  +upstreamnt  +downstreamnt
atgacaagcgacgactttaagaaatccaccgctaatttgaaaaaagcggtacctttgatg
attaagaatcacgtagctgccacacccgcaaactatgccctttggtatacctacgtggac
aacaccattcctcaactcaaccaggaaatggataccgttttagaaaactacggtatctgc
ccacccgcgactaacgagcagctctacaacaactacgtagcaagcaaagcggaaaccagc
atgaaggacctgagaagcaacattgaagtgttgttgctcgaggttgcgagctccatgacg
gataccatcgcggacacttcctctttttcgaccctcgttgataaaaatttcagcaagtta
gagaaagtcgaagacgaaggcttgagcattgaagaagtgatgggcgttatacgtgaactg
gtgacggagtcacgcgagatccgccactccacccgtttccttacgagccaactcaataac
gcgagcaacgaaatctctcgcttgaaagagcagttagcggaagtgcaaagagacgctctc
tttgatggattatccacgctttacaatcgccgcgcgttcgatagtgatctcaaggcactc
gtgaatgcccagcaaaacctaagccttatcttgctcgacatcgatcattttaaaactttc
aacgacaactatggccatctgtttggcgattcggtgattcgcgcgattgccaaacgactg
caaacaagttgccgtgaaggcattgcagcgtatcgatttggcggagaagagtttgcattg
attgtgcccaataaatctctgcgcattgctcgtcaatacgctgagtcacttcgccgcact
atcgaaaaactgaaagtcaaagataaacgctctggccagcaagtggaaaacatcagtgct
tcatttggtgttgccgagttgaagccagacgaaaccgcagaatcgttgatcgaacgtgca
gacaaactgctttatgaagcgaagcaacttggtcgtaaccgcgtaatgccactgtaa

DBGET integrated database retrieval system